RESEARCH ARTICLE
An RNAi-BasedControl of Fusarium
graminearum Infections Through Spraying of
Long dsRNAs Involves a Plant Passage and Is
Controlled by the Fungal SilencingMachinery
Aline Koch1, Dagmar Biedenkopf1, Alexandra Furch2, Lennart Weber3, Oliver Rossbach4,
Eltayb Abdellatef1, Lukas Linicus1, Jan Johannsmeier1, Lukas Jelonek5,
Alexander Goesmann5, Vinitha Cardoza6, John McMillan6, Tobias Mentzel7, Karl-
Heinz Kogel1*
a11111
1 Institute for Phytopathology, Centre for BioSystems, Land Use and Nutrition, Justus Liebig University,
Giessen, Germany, 2 Institute of General Botany and Plant Physiology, Friedrich-Schiller-University, Jena,
Germany, 3 Institute for Microbiology and Molecular Biology, Centre for BioSystems, Land Use and
Nutrition, Justus Liebig University, Giessen, Germany, 4 Institute of Biochemistry, Centre for BioSystems,
Land Use and Nutrition, Justus Liebig University, Giessen, Germany, 5 Institute for Bioinformatics and
Systems Biology, Centre for BioSystems, Land Use and Nutrition, Justus Liebig University, Giessen,
Germany, 6 BASF Plant Science LP, Research Triangle Park, Durham, North Carolina, United States of
America, 7 BASF SE, Limburgerhof, Germany
OPENACCESS
Citation: Koch A, Biedenkopf D, Furch A, Weber L, * karl-heinz.kogel@agrar.uni-giessen.de
Rossbach O, Abdellatef E, et al. (2016) An RNAi-
Based Control of Fusarium graminearum Infections
Through Spraying of Long dsRNAs Involves a Abstract
Plant Passage and Is Controlled by the Fungal
Silencing Machinery. PLoS Pathog 12(10):
Meeting the increasing food and energy demands of a growing population will require the
e1005901. doi:10.1371/journal.ppat.1005901
development of ground-breaking strategies that promote sustainable plant production.
Editor: Savithramma P. Dinesh-Kumar, University
Host-induced gene silencing has shown great potential for controlling pest and diseases in
of California, Davis Genome Center, UNITED
STATES crop plants. However, while delivery of inhibitory noncoding double-stranded (ds)RNA by
transgenic expression is a promising concept, it requires the generation of transgenic crop
Received: December 2, 2015
plants which may cause substantial delay for application strategies depending on the trans-
Accepted: August 28, 2016
formability and genetic stability of the crop plant species. Using the agronomically important
Published: October 13, 2016 barley—Fusarium graminearum pathosystem, we alternatively demonstrate that a spray
Copyright: © 2016 Koch et al. This is an open application of a long noncoding dsRNA (791 nt CYP3-dsRNA), which targets the three fun-
access article distributed under the terms of the gal cytochrome P450 lanosterol C-14α-demethylases, required for biosynthesis of fungal
Creative Commons Attribution License, which
ergosterol, inhibits fungal growth in the directly sprayed (local) as well as the non-sprayed
permits unrestricted use, distribution, and
reproduction in any medium, provided the original (distal) parts of detached leaves. Unexpectedly, efficient spray-induced control of fungal
author and source are credited. infections in the distal tissue involved passage of CYP3-dsRNA via the plant vascular sys-
Data Availability Statement: All relevant data are tem and processing into small interfering (si)RNAs by fungal DICER-LIKE 1 (FgDCL-1)
within the paper and its Supporting Information after uptake by the pathogen. We discuss important consequences of this new finding on
files.
future RNA-based disease control strategies. Given the ease of design, high specificity,
Funding: This work was supported by the German and applicability to diverse pathogens, the use of target-specific dsRNA as an anti-fungal
Research Council (Deutsche
agent offers unprecedented potential as a new plant protection strategy.
Forschungsgemeinschaft, DFG) KO1208/23-1 and
was supported by grants from the LOEWE
program Medical RNomics (State of Hessen; to
OR). The funders had no role in study design, data
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 1 / 22
RNAi-Based Control of Fusarium graminearum
collection and analysis, decision to publish, or
preparation of the manuscript. Author Summary
Competing Interests: I have read the journal’s RNA interference has emerged as a powerful genetic tool for scientific research. The dem-
policy and the fact that the authors VC, JM, and TM onstration that agricultural pests, such as insects and nematodes, are killed by exoge-
are employed by a commercial company BASF
nously supplied RNA targeting their essential genes has raised the possibility that plant
Resesarch Triangle Park and BASF Limburgerhof
does not alter our adherence to all PLOS predation can be controlled by lethal RNA signals.We show that spraying barley with a
Pathogens policies on sharing data and materials. 791 nt long dsRNA (CYP3-dsRNA) targeting the three fungal ergosterol biosynthesis
genes (CYP51A,CYP51B,CYP51C), whose respective proteins also are known as azole
fungicide targets, efficiently inhibited the necrotrophic fungus Fusarium graminearum in
directly sprayed and systemic leaf tissue. Strong inhibition of fungal growth required an
operational fungal RNA interference mechanism as demonstrated by the fact that a
Fusarium DICER-LIKE-1 mutant was insensitive to CYP3-dsRNA in systemic, non-
sprayed leaf areas. Our findings will help in the efficient design of RNAi-based plant dis-
ease control. We provide essential information on a fundamentally new plant protection
strategy, thereby opening novel avenues for improving crop yields in an environmentally
friendly and sustainable manner.
Introduction
According to the FAO [1], more than half of the world’s harvested area is allotted to cereals
such as rice, maize and wheat (ca. 2.3 billion tons in 2010). Diseases of cereal crops such as
Fusarium head blight (FHB) and Fusarium seedling blight (FSB), caused by necrotrophic fungi
of the genus Fusarium, exert a particularly great economic and agronomic impact on global
grain production and the grain industry [2,3]. Food safety can be compromised by contamina-
tion of agricultural products with mycotoxins, which are produced during FHB and FSB devel-
opment [4] and represent a serious threat to human and animal health. Currently, the major
strategies to control Fusarium diseases include resistance breeding, crop rotation, and biologi-
cal control along with the application of DMI (demethylation inhibitors) fungicides [5]. DMI
fungicides, such as tebuconazole, triadimefon, and prochloraz inhibit ergosterol biosynthesis
by binding to cytochrome P450 lanosterol C-14 α-demethylase (CYP51), thereby disrupting
fungal membrane integrity [6]. However, heavy reliance on DMI fungicides since their discov-
ery in the mid-1970s holds a risk of the emergence of DMI-tolerant strains of plant pathogens.
Conventional plant breeding strategies have been only partly successful, as the quantitative
nature of FHB and FSB resistance does not allow straightforward breeding programs.
Since the discovery in 1998 that exogenous double-stranded (ds)RNA triggers suppression
of gene activity in a homology-dependentmanner [7], along with the identification of small
RNAs (sRNAs) as a new class of regulatorymolecules [8] that functions via RNA interference
(RNAi), our understanding of the essential cellular function of gene silencing has increased
considerably [9–10]. Mobile RNA silencing signals are capable of translocating from the host
to its interacting organism, and vice versa [11–14]. Recent evidence supports the significant
contribution of sRNAs and RNAi to the communication between plant hosts and a pathogenic
fungus [15]. Exploiting the RNAi mechanism in plants also has a strong potential for agricul-
ture. Indeed, expression of inhibitory dsRNAs in the corresponding host plant conferred pro-
tection from predation or infection by targeted gene silencing [16–18], a phenomenon that has
been termed host-induced gene silencing (HIGS).
Recently, we demonstrated that in Arabidopsis (Arabidopsis thaliana) and barley (Hordeum
vulgare), transgenic expression of CYP3-dsRNA, a 791 nt long dsRNA targeting the three fun-
gal CYP51 genes involved in ergosterol biosynthesis, confers resistance to infectionwith
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 2 / 22
RNAi-Based Control of Fusarium graminearum
Fusarium graminearum [19]. While these results provided proof-of-concept that RNAi-based
plant protection is an effective strategy for controlling diseases caused by devastating necro-
trophic pathogens, the broad applicability of this transgenic method remains questionable due
to the persisting weak acceptance of GMO strategies for food and feed production in many
countries.More important, a broad application of this transgenic approach is hampered by the
lack of transformability of various crop plants and the missing genetic stability of the silencing
trait. Here we investigate the potential and the mechanism of an RNAi-based crop protection
strategy using direct spray applications of CYP3-dsRNA to target F. graminearum. We show
that the 791 nt long dsRNA is taken up by the plant and transferred in an unmodified form via
the vascular system to fungal infection sites where it is processed by the fungal RNAi machin-
ery as a prerequisite for its antifungal activity. We show a strong correlation between accumu-
lation of CYP3-dsRNA at infection sites, silencing of CYP51 expression, and fungal inhibition.
Results
Spray-induced gene silencing (SIGS) of Fusarium genes
To provide a proof of concept, we conducted an experiment targeting the expression of the jel-
lyfish green fluorescent protein (GFP) in the GFP-expressing F. graminearum strain Fg-
IFA65GFP [20] by using a GFP-specific 720 nt long dsRNA (GFP-dsRNA, S1 Fig). Detached
barley leaves were locally sprayed with 20 ng μL-1 GFP-dsRNA or Tris-EDTA buffer (TE, con-
trol) and drop-inoculated 48 h later with Fg-IFA65GFP in the distal (non-sprayed) leaf segment.
Confocalmicrocopy showed strong GFP fluorescence associated with fungal mycelia on TE-
treated control leaves at six days post inoculation (dpi) (Fig 1A). In contrast, fluorescence (Fig
1B) and GFP transcripts (Fig 1C) were largely absent in mycelia grown on leaves that were
locally sprayed with GFP-dsRNA, althoughmycelial growth was unrestricted as evidencedby
light microscopy. This observation clearly demonstrates the possibility of targeting a gene of an
attacking microbe via SIGS.
To further explore the potential of SIGS, we assessed the silencing efficiencyof CYP3-
dsRNA, which targets the three Fusarium genes CYP51A,CYP51B, and CYP51C. The 791 nt
long CYP3-dsRNA contains complementary fragments of these genes starting with N-terminal
CYP51B, followed by CYP51A and CYP51C [19]. Leaves were sprayed with CYP3-dsRNA and
48 h later drop-inoculated directly onto the sprayed area with Fg-IFA65. At six dpi, CYP3-
dsRNA-treated leaves developed brownish lesions that were substantially smaller than those on
TE- or GFP-dsRNA-sprayed leaves that served as control in this experiment (Fig 2A). Quanti-
tative real-time PCR (qPCR) analysis of fungal DNA levels, based on the ratio between fungal
tubulin and plant ubiquitin, confirmed reduced fungal growth on CYP3-dsRNA-treated leaves
(Fig 2B). To confirm that inhibition of Fusarium growth by CYP3-dsRNA was provoked by
sequence-specificgene silencing, expression of all the three fungalCYP51 genes was assessed.
At six dpi, total RNA was isolated from infected leaves and the levels of CYP51A,CYP51B and
CYP51C transcripts were measured by qPCR and normalized to the expression of the fungal ß-
tubulin gene. Consistent with the concept of spray-induced gene silencing, we found that the
relative amounts of CYP51 transcripts were reduced on average by 58% (CYP51A), 50%
(CYP51B), and 48% (CYP51C) in leaves sprayed with CYP3-dsRNA vs. the GFP-dsRNA con-
trol (Fig 2C).
SIGS confers strong resistance against Fusarium in distal leaf parts
Mobile cell non-autonomous inhibitory RNAs that spread gene silencing into adjacent cells
and tissues have been observed in various plants [21–23]. Encouraged by the observed reduc-
tion in GFP fluorescence in Fg-IFA65GFP upon infection of leaf segments that did not receive a
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 3 / 22
RNAi-Based Control of Fusarium graminearum
Fig 1. (A-C) Spray-induced gene silencing (SIGS) of GFP expression in Fusarium graminearum strain Fg-IFA65GFP. Detached
second leaves of three-week-old barley plants were locally sprayed with Tris-EDTA (TE, A, control) or GFP-dsRNA (B). Forty-eight hours
after spraying, distal, non-sprayed leaf segments were drop-inoculated with Fg-IFA65GFP (20 μL of a solution containing 2 x 104 conidia
mL-1). GFP silencing efficiency was visualized 6 dpi using confocal microscopy. (C) GFP transcripts were quantified by qPCR at 6 dpi. The
reduction in fungal GFP expression on leaves sprayed with GFP-dsRNA and infected with Fg-IFA65GFP compared with TE-sprayed
controls was statistically significant (***P < 0.001; Student´s t test). Bars represent mean values ± SDs of three independent experiments.
Scale bars represent 100 μm.
doi:10.1371/journal.ppat.1005901.g001
directGFP-dsRNA spray (see Fig 1), we tested whether locally sprayed CYP3-dsRNA confers
gene silencing in Fusarium infecting distal, non-sprayed segments of barley leaves. To this end,
the upper part of detached leaves (local tissue) was sprayed with 20 ng μL-1 CYP3-dsRNA,
GFP-dsRNA, or TE, while the lower part (distal tissue) was covered by a plastic tray to prevent
direct dsRNA contamination. After 48 h, the distal, non-sprayed part of the leaves was drop-
inoculatedwith Fg-IFA65GFP; six days later, resistance to fungal infectionwas assessed. Distal
leaf areas of CYP3-dsRNA-treated leaves developed substantially smaller lesions as compared
to leaves sprayed withGFP-dsRNA or TE (S2 Fig) indicating that the silencing signal was
basipetally transported. Consistent with this finding, the amount of fungal DNA as determined
by qPCR was greatly reduced in the distal leaf area as compared to the control treatments (Fig
3A). The relative amounts of fungalCYP51A,CYP51B and CYP51C transcripts were strongly
reduced on average by 72% (CYP51A), 90% (CYP51B), and 71% (CYP51C) as compared with
control (GFP-dsRNA) treatment (Fig 3B). Confocalmicroscopy of fungal inoculation sites in
distal leaf areas confirmed that, on TE-treated leaves, Fg-IFA65GFP conidia had germinated
and colonized tissue next to the inoculation site (Fig 3C). In contrast, fungal mycelia on CYP3-
dsRNA-treated leaves were only visible at the inoculation sites, and the surrounding leaf tissue
was free of infection hyphae (Fig 3D). Consistent with this, the large number of fungal conidia
with very short germ tubes at the inoculation sites of CYP3-dsRNA-treated leaves indicated
that fungal germination was strongly impaired. We also tested whether the silencing signal was
transported in the acropetal direction. Segments were sprayed with 20 ng μL-1 CYP3-dsRNA
and subsequently drop-inoculated in the distal leaf area. Fusarium infections were also reduced
in the acropetal experimental set up (S3A Fig) as shown by macroscopic inspection (S3B Fig)
and qPCR quantification of fungal DNA (S3C Fig).
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 4 / 22
RNAi-Based Control of Fusarium graminearum
Fig 2. (A-C) SIGS-mediated control of F. graminearum on leaves sprayed with CYP3-dsRNA. (A) Detached second
leaves of three-week-old barley were sprayed evenly with CYP3-dsRNA, TE (mock control), and GFP-dsRNA (negative
control), respectively. After 48 hours, leaves were drop-inoculated with 2 × 104 conidia mL−1 of Fg-IFA65 onto the sprayed
area and evaluated for necrotic lesions at 6 dpi. (B) The relative amount of fungal DNA at 6 dpi as measured by qPCR was
reduced in CYP3-dsRNA-treated leaves compared to control leaves. Bars represent mean values ± SDs of three
independent experiments. The reduction of fungal growth on CYP3-dsRNA vs. TE- or GFP-dsRNA-sprayed leaves was
statistically significant (*P < 0.05; Student´s t test). (C) Gene-specific qPCR analysis of fungal CYP51A, CYP51B, and
CYP51C transcripts at 6 dpi (corresponding to 8 d after spraying). The reduction in fungal CYP51 gene expression on
CYP3-dsRNA-sprayed leaves as compared with GFP-dsRNA-sprayed controls was statistically significant (*P < 0.05,
**P < 0.01, ***P < 0.001; Student´s t test).
doi:10.1371/journal.ppat.1005901.g002
Uptake and processing of sprayed CYP3-dsRNA
To further explore the SIGS mechanism, we investigated whether the spray-applied long
CYP3-dsRNA is translocated in the plant tissue and/or processed by the plant’s silencing
machinery independent of fungal infections. Following CYP3-dsRNA treatment, local
(sprayed) and distal (non-sprayed) leaf segments were harvested separately at 24, 48, 72, or 168
h after spraying. Northern blot analysis detected unprocessed 791 nt CYP3-dsRNA in both
local and distal tissue (Fig 4A), showing that the long dsRNA is systemically translocated
within the plant. In the local (sprayed) segment,CYP3-dsRNA was detected over the full time
range, while it accumulated only transiently at early time points (24 h) after spraying in the
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 5 / 22
RNAi-Based Control of Fusarium graminearum
Fig 3. (A-D) SIGS-mediated semi-systemic control of Fusarium graminearum. (A) Upper parts of detached second leaves of three-
week-old barley were sprayed evenly with CYP3-dsRNA, TE, and GFP-dsRNA, respectively. After 48 h, the non-inoculated, semi-systemic
(distal) tissue was drop-inoculated with 2 × 104 conidia mL−1 of Fg-IFA65GFP; the relative amount of fungal DNA in distal tissue, as
measured by qPCR at 6 dpi, was reduced in CYP3-dsRNA-treated leaves. Bars represent mean values ± SDs of three independent
experiments. The reduction of fungal growth on CYP3-dsRNA-sprayed leaves was statistically significant (**P < 0.01; Student´s t test). (B)
Gene-specific qPCR analysis of CYP51A, CYP51B, and CYP51C transcripts at 6 dpi in distal leaf areas. Bars represent mean values ±SDs
of three independent sample collections. The reduction in CYP51 expression in leaves sprayed with CYP3-dsRNA compared with GFP-
dsRNA-sprayed controls was statistically significant (**P < 0.01, ***P < 0.001; Student´s t test). (C,D) Microscopy of fungal growth at
semi-systemic sites of drop-inoculation with Fg-IFA65GFP. (C) Successful fungal colonization (green) on TE-sprayed leaves. Profuse
hyphal growth is seen inside the cells (plasma membrane stained with RH414 is highlighted in red) (D) Hyphal formation is strongly
reduced and confined to the inoculated leaf area on CYP3-dsRNA-sprayed leaves. Impaired spore germination was observed in the area
around the inoculation site while the surrounding cells remained free of colonization. (IF, infection hyphae; GS, germinating spore).
Photographs for C and D were taken at 6 dpi.
doi:10.1371/journal.ppat.1005901.g003
distal (non-sprayed segments). This accumulation profile is consistent with the idea that the
vast bulk of the CYP3-dsRNA fractionwas absorbed via the cut surface of the detached leaf.
Moreover, CYP3-dsRNA-derived 21 nt and 22 nt small interfering (si)RNAs also accumulated
over the whole time range after spraying in the local leaf segments, demonstrating that CYP3-
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 6 / 22
RNAi-Based Control of Fusarium graminearum
Fig 4. (A,B) Northern gel blot analysis of CYP3-dsRNA and CYP3-dsRNA-derived siRNA
accumulation in local and distal (semi-systemic) barley leaf areas. (A) Detection of 791 nt long CYP3-
dsRNA precursor in pooled leaf tissue from non-infected leaves using [α-32P]-dCTP labeled CYP3-dsRNA
as probe. Local (L) and distal (semi-systemic [S]) leaf segments were sampled separately at the indicated
times after spraying with CYP3-dsRNA. No signal was detected in samples from TE-sprayed plants. (B)
Recording CYP3-dsRNA-derived small RNAs in local and distal (semi-systemic) leaf areas using [α-32P]-
dCTP labeled CYP3-dsRNA as probe. In this experiment, small RNAs could not be detected in distal (non-
sprayed) tissues. siRNA generated in vitro by a commercial Dicer preparation from CYP3-dsRNA was used
as positive control. No signal was detected in samples from TE-sprayed plants. Ethidium bromide-stained
rRNA served as the loading control. Signals originate from the same membrane but different exposure times.
doi:10.1371/journal.ppat.1005901.g004
dsRNA was partly processed by the plant (Fig 4B). In this experiment, Northern analysis could
not detect siRNAs in distal leaf parts, probably because the technique was not sensitive enough.
To further investigate uptake and transport of sprayed CYP3-dsRNA, it was labeled with the
green fluorescent dye ATTO 488 (CYP3-dsRNAA488) and sprayed onto barley leaves. The bio-
logical activity of CYP3-dsRNAA488 was indistinguishable from non-labeledCYP3-dsRNA as
evidencedby reduced fungal infection and strong silencing of fungalCYP51 genes upon spray
application (S4A–S4C Fig). Moreover, using confocal laser scanningmicroscopy, a green fluo-
rescent signal was detected in the vascular tissue at 24 hours after spraying leaves with 20
ng μl-1 CYP3-dsRNAA488. In leaf cross-sections, fluorescencewas seen in the xylem (Fig 5A–
5C). Inspection of longitudinal leaf sections revealed that the fluorescencewas not confined to
the apoplast but also was present in the symplast of phloem parenchyma cells, companion
cells, and mesophyll cells, as well as in trichomes and stomata (Fig 5D–5I).When CYP3-
dsRNAA488-sprayed leaves were inoculatedwith Fg-IFA65, the fluorescent signal also was
detectable inside fungal conidia and germ tubes (Fig 5H) and fungal mycelium (Fig 5J and S5
Fig). Together these data show that CYP3-dsRNA is taken up by the plant and is transferred
via the plant vascular system. Systemic translocation within the plant and accumulation by the
fungus also raised the possibility that CYP3-dsRNA is processed by the fungus into inhibitory
siRNAs to eventually target fungalCYP51 genes.
To test this possibility, we first profiledCYP3-dsRNA-derived siRNAs in infected and non-
infected leaves. Small RNA sequencing (RNAseq) analysis revealed distinctly different CYP3-
dsRNA-derived siRNA profiles in mock- vs. Fg-IFA65-infected local and distal (non-sprayed)
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 7 / 22
RNAi-Based Control of Fusarium graminearum
Fig 5. (A-J) Confocal laser scanning microscopy of ATTO 488-labeled CYP3-dsRNAA488 in locally sprayed barley leaves. (A-C)
Detection of CYP3-dsRNAA488 (green) in xylem vessels of vascular bundles 24 h after spraying. (D-G) Longitudinal sections reveal uptake
of CYP3-dsRNAA488 by cells of the phloem tissue at 24 h after spraying. SE, sieve element; CC, companion cell; SP, sieve plate; PPC,
phloem parenchyma cell; MC, mesophyll cell. The red cells result from the autofluorescence of chloroplasts (F,G). (H-J) Leaf hair cells
(trichome), stomata, germinating spores (GS) and fungal hyphae strongly accumulated CYP3-dsRNAA488. Fungal hyphae (IF) are stained
with chitin-specific dye WGA-Alexa Fluor 594 (red) 24 h after inoculation. EC, epidermal cells. RNA signals in germinated conidia are
marked by arrow heads. Scale bars 100 μm (A-H), 20 μm (F), and 10 μm (J).
doi:10.1371/journal.ppat.1005901.g005
leaf segments (Fig 6A and 6B) with higher numbers of reads of CYP3-dsRNA-derived siRNAs
in infected leaves, and highest numbers of reads in locally-inoculatedvs. distally-inoculated
leaves. These data suggest that CYP3-dsRNA also is processed by the fungus and that the fungal
silencingmachinery is involved in SIGS and reduced fungal infections. Detection by RNAseq
of CYP3-dsRNA-derived siRNA in the distal (non-sprayed) part of leaves also supported our
interpretation that northern analysis failed to detect low amounts of these siRNAs due to sensi-
tivity problems.
Fungal DICER-LIKE-1 is required for efficient SIGS in systemic leaf
areas
To further substantiate involvement of the fungal silencingmachinery, we generated a fungal
dcl-1mutant (Fg-IFA65Δdcl-1) that is deficient for DICER-LIKE 1 (S6 Fig), a critical component
of the fungal silencingmachinery that produces siRNA from long dsRNA stretches. Fg-
IFA65Δdcl-1 and the wild type Fg-IFA65 were indistinguishably virulent on TE-sprayed barley
leaves (Fig 7A), showing that fungal DCL-1 is not required for successful leaf infections. How-
ever, in contrast to Fg-IFA65, the mutant Fg-IFA65Δdcl-1 also heavily infected distal areas of
CYP3-dsRNA-treated barley leaves (Fig 7B), suggesting that the mutant strain is not amenable
to SIGS. We concluded that the fungal silencingmachinery appears to be indispensable for
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 8 / 22
RNAi-Based Control of Fusarium graminearum
Fig 6. (A,B) RNA profiling (RNAseq analysis) of CYP3-dsRNA-derived RNAs in local and distal tissue of CYP3-dsRNA-treated
barley leaves on Illumina HiSeq. Higher numbers of reads of CYP3-dsRNA-derived sRNAs were found in infected vs. non-infected
leaves both in the sprayed (local [A]) and non-sprayed (semi-systemic [B]) leaf area at 6 dpi with strain Fg-IFA65.
doi:10.1371/journal.ppat.1005901.g006
CYP3-dsRNA-mediated SIGS at systemic areas in the barley-Fusarium graminearum pathosys-
tem. To further confirm that FgDCL-1 is required for CYP51 target gene silencing, levels of
CYP51A,CYP51B and CYP51C transcripts were compared by qPCR in the wild type vs. the
dcl-1mutant on infection of CYP3-dsRNA sprayed leaves. The relative amounts of transcripts
were reduced in Fg-IFA65 on average by 50% (CYP51A), 70% (CYP51B), and 40% (CYP51C)
as compared with TE (control) treatment. In contrast, expression of CYP51 targets was not
reduced in the Fg-IFA65Δdcl-1 mutant (Fig 7C).
We additionally conducted an in vitro experiment to further demonstrate the requirement of
FgDCL-1 for CYP3-dsRNA-mediated silencing of fungalCYP51 genes. Mycelia of axenic cul-
tures of Fg-IFA65 and Fg-IFA65Δdcl-1 were treated with CYP3-dsRNA. Subsequently, expression
of CYP51 genes was recorded. Consistent with the leaf assay, the relative amounts of fungal
CYP51A,CYP51B and CYP51C transcripts were reduced in the wild type Fg-IFA65 but not in
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 9 / 22
RNAi-Based Control of Fusarium graminearum
Fig 7. (A-E) The fungal silencing machinery is required for efficient SIGS in distal leaf parts. (A,B) The
fungal dicer-like-1 mutant Fg-IFA65Δdcl-1 heavily infected barley leaves despite a prior spray-treatment with
CYP3-dsRNA. Photographs were taken at 6 dpi. (C) Gene-specific qPCR analysis of CYP51A, CYP51B, and
CYP51C transcripts in the wild type Fg-IFA65 and the mutant Fg-IFA65Δdcl-1 at 6 dpi in the distal, semi-
systemic leaf areas. (D) Inhibition of CYP51 gene expression upon CYP3-dsRNA treatment of axenically
grown Fg-IFA65- Bars represent mean values ±SDs of three independent sample collections. The reduction
in CYP51 expression in samples treated with CYP3-dsRNA compared with mock-treated controls was
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 10 / 22
RNAi-Based Control of Fusarium graminearum
statistically significant (*P < 0.05, **P < 0.01; Student´s t test). (E-G) Profiling of CYP3-dsRNA-derived
sRNAs in axenically grown Fg-IFA65. (E) Scaffold of the 791 nt long CYP3-dsRNA. The fragments of CYP51
genes are indicated. (F,G) Total sRNAs were isolated from axenically-cultured Fg-IFA65. sRNA reads of
fungal sRNAs from untreated (F) and CYP3-dsRNA-treated (G) fungal cultures are mapped to the sequence
of CYP3-dsRNA.
doi:10.1371/journal.ppat.1005901.g007
the Fg-IFA65Δdcl-1 mutant (Fig 7D). Confirmatory total sRNAs profiling by RNAseq in axeni-
cally-grown Fg-IFA65 revealed a range of sRNAs originating from CYP3-dsRNA (Fig 7E–7G
and S2 Table), further proving that the fungus can process CYP3-dsRNA. Suspiciously, the
majority of siRNA speciesmapped to sites in the CYP51A gene fragment of the CYP3-dsRNA.
Further work must show if this profile is a result of the physical structure of the dsRNA.
CYP3-dsRNA-derived siRNAs also confer SIGS
The failure to detectCYP3-dsRNA-derived siRNA in the distal area of CYP3-dsRNA-sprayed
leaves by northern analysis along with the compromised SIGS phenotype of the mutant Fg-
IFA65Δdcl-1 suggested that the concentration of siRNA in the distal leaf parts was too low to
mediate silencing of CYP51 genes in the fungus. Alternatively, Fusarium is generally unable to
absorb siRNA from barley leaves. To address these possibilities, we sprayed barley leaves with
high concentration of CYP3-dsRNA-derived siRNAs (20 ng μl-1) and subsequently inoculated
local (sprayed) and distal (non-sprayed) leaf segments with Fg-IFA65. We found that the fun-
gus was strongly inhibited by these siRNAs both in the local (S7A and S7C Fig) and distal leaf
segments (S7B and S7C Fig) as compared with a control (GFP-dsRNA-derived siRNAs). Con-
sistent with this, CYP3-dsRNA-derived siRNA also reduced the expression of CYP51 genes of
the fungus growing on local (S7D Fig) and distal leaves segments (S7E Fig), which shows that
F. graminearum also can ingest inhibitory siRNAs from plant tissue. In clear support of this
notion and consistent with the finding that CYP3-dsRNA-derived siRNA accumulated to
higher concentration in leaf areas directly sprayed with CYP3-dsRNA, mutant Fg-IFA65Δdcl-1
was not compromised in SIGS when drop-inoculated directly to the sprayed leaf area (S8 Fig).
SIGS-mediated fungal inhibition is independent of innate immune
responses
In mammalian cells, perception of certain dsRNAs via toll-like receptors triggers an inflamma-
tion response [24,25]. Therefore, we assessed whetherCYP3-dsRNA elicits an innate immune
response called pattern-triggered immunity (PTI) [26], when sprayed onto barley leaf seg-
ments. To this end, expression of barley genes that are indicative of the canonical defense-
related salicylate- and jasmonate-dependent pathways [27] was evaluated. Expression of salicy-
late-responsive pathogenesis-related 1 (HvPR1) and jasmonate-responsive S-adenosyl-l-methio-
nine:jasmonic acid carboxyl methyltransferase (HvJMT) in TE-treated leaves was strongly
induced by Fg-IFA65, but not by CYP3-dsRNA treatment (Fig 8). Furthermore, Fg-IFA65-in-
duced expression of either gene was much lower in CYP3-dsRNA-treated leaves as compared
with TE-treated leaves. This result strongly suggests that CYP3-dsRNA does not induce PTI in
barley, and that the SIGS mechanism does not rely on activation of canonical defense path-
ways. The finding also is relevant when considering the fitness cost, and thus yield, of the SIGS
strategy.
Discussion
In this study, we show that delivery of long noncoding double-stranded RNA targeting the
three CYP51 genes of the necrotrophic ascomycete fungus Fusarium graminearum via spray
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 11 / 22
RNAi-Based Control of Fusarium graminearum
Fig 8. (A,B) Defense-related salicylate- and jasmonate-responsive genes are not induced by CYP3-dsRNA. Detached
second leaves of three-week-old barley were sprayed with 20 ng μL-1 CYP3-dsRNA or TE (control), respectively, and 48 h later
drop-inoculated with Fg-IFA65. Leaves were harvested 6 dpi and analyzed for gene expression by qPCR: (A) Pathogenesis-
related 1 (HvPR1) and (B) S-adenosyl-l-methionine:jasmonic acid carboxyl methyltransferase (HvJMT). Both genes are highly
responsive to Fg-IFA65 but not to CYP3-dsRNA or TE treatment. Please note that a combined treatment of CYP3-dsRNA
followed by Fg-IFA65 48 h later also did not induce these marker genes, which shows independently that fungal development on
CYP3-dsRNA-treated leaves is strongly inhibited.
doi:10.1371/journal.ppat.1005901.g008
application effectively reduces the development of the pathogen on barley leaves. Thus, our
work further supports the idea that RNA could be used as a chemical treatment to control
plant diseases.
Next to the economic and ecologic consideration about the deployment of antimicrobial
RNAs as a new plant protection measure, elucidating the molecularmechanisms of RNA-
based disease control is a key for successful future implementation. While plant-derived trans-
gene-mediated silencing of target genes in plant pathogens and pests (a mechanism known as
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 12 / 22
RNAi-Based Control of Fusarium graminearum
host-induced gene silencing [HIGS]) has been frequently reported [12,14,19], few examples
have demonstrated the efficiencyof exogenous RNA delivery to kill plant attackers. HIGS vir-
tually is based on the plant’s silencingmachinery, whereas the mechanism of gene silencing by
exogenously delivered dsRNA constitutes a more complex situation. For instance, diverging
questions are possible involvement of the silencingmachineries of host and/or the pathogen/
pest, the requirement of local and remote transport of channeled dsRNA molecules, and the
problem of dsRNA transport at the apoplast–symplast interface.
Using the F. graminearum—barley pathosystem as a model to study the mechanism of
exogenously applied inhibitory dsRNA was motivated by the fact that FusariumHead Blight
and Crown Rot cause serious problems worldwide including food and feed safety issues due to
mycotoxin contamination of cereals and maize. Focusing on fungal CYP51 genes as targets for
silencing was reasonable because our previous work provided proof-of-concept that transgene-
mediated silencing of these genes effectively reduced fungal development in Arabidopsis and
barley. More than that, direct treatment of F. graminearum with inhibitory dsRNA matching
CYP51 gene sequences had been demonstrated to inhibit fungal development in axenic cultures
[19].
The previous finding of impaired fungal growth in axenic cultures, when treated with a 791
nt dsRNA (CYP3-dsRNA) targeting the three fungal genes CYP51A,CYP51B, and CYP51C, let
us speculate that the fungus can process CYP3-dsRNA into siRNA that interfere with the
expression of CYP51 genes. Gene annotation of F. graminearum’s genome (http://www.
broadinstitute.org) predicted genes coding for two ARGONAUTE-like proteins, two DICER-
like proteins and five RNA-dependent RNA Polymerases (RDR), suggesting that the RNAi
pathway is functional [28]. Consistent with these findings, RNAseq analysis of axenically
grown F. graminearum, treated with CYP3-dsRNA, showed high numbers of reads of CYP3-
dsRNA-derived siRNA (Fig 7). Together these data showed that F. graminearum possesses a
functional gene silencing system, which is a prerequisite for disease control by SIGS.
To test the antifungal activity of CYP3-dsRNA and their siRNA derivatives, we used a
detached leaf assay that enabled us to assess fungal growth in local (directly sprayed) and distal
(semi-systemic, non-sprayed) leaf segments. Using this approach, we could demonstrate that
inhibitory dsRNA translocated via the plant vascular system and eventually was absorbed by
the pathogen from leaf tissue (Fig 5). The profile of inhibitory dsRNA accumulation, as demon-
strated by northern blot analysis (Fig 4) and RNAseq (Fig 6), showed that both long CYP3-
dsRNA and plant-processed CYP3-dsRNA-derived siRNA accumulate in the plant vascular
system, though translocation of siRNA seems to be less efficient and thus siRNA concentration
at the remote infection sites probably was not high enough to induced SIGS. Consistent with
this notion, in planta producedCYP3-dsRNA-derived siRNAs was detected in the distal leaf
parts only by the more sensitive RNAseq technique but not by northern analysis. Nevertheless,
spraying high concentrations of CYP3-dsRNA-derived siRNA (20 ng μL-1) induced the SIGS
process (S7 Fig), demonstrating that the fungus is able to absorb siRNAs from barley leaves.
Because of the less efficientmovement of siRNAs, transport and translocation of the unpro-
cessed 791 nt dsRNA has a critical role in the SIGS process, demonstrated by a compromised
SIGS phenotype of the Fusariummutant Fg-IFA65Δdcl-1 at distal leaf segments (Fig 7) but not
at local, directly sprayed leaf segments (S8 Fig). Compromised DICER activity resulted in the
fungus inability to cleave CYP3-dsRNA into siRNA, thus interrupting the RNA interference
mechanism in case the concentration of CYP3-dsRNA-derived siRNA is not sufficiently high.
Our finding that the unprocessed long dsRNA could be absorbed from leaf tissue has further
implications for future disease control strategies using dsRNA. There are good arguments that
application of longer dsRNAs might be more efficient than application of siRNAs given there
more efficient translocation. Long dsRNA would be processed into many different inhibitory
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 13 / 22
RNAi-Based Control of Fusarium graminearum
siRNA by the fungus, which not least also could be an issue when considering the risk of com-
pound resistance emerging in a pathogen under field test conditions. Thus, based on our find-
ings, further research is required to establish rules for optimal dsRNA structures, considering
e.g. molecule lengths, combinatorial order of gene fragments, target sites in a given gene target,
and the number of genes targeted by one dsRNA. Supporting the requirement for more infor-
mation as to the design of dsRNA probes, RNAseq analysis revealed that most of the CYP3-
dsRNA-derived siRNAs, accumulating in the axenic fungal mycelium, were not equally distrib-
uted at the CYP3-dsRNA scaffold, but accumulated at the CYP51A gene fragment (Fig 7 and
S2 Table). Further analysis is required to explain this bias in the production of siRNAs from
CYP3-dsRNA.
Our results are also consistent with the view that inhibitory dsRNA is more effectively
absorbed by the fungus through infection hyphae that have intimate contact to plant tissue
(compare CYP51 gene expression in Figs 2 and 3). How these hyphae differ from the fungal
germ tubes and extracellular hyphae is however yet unclear although distinct biochemical
modifications of fungal hyphae that penetrate host plants and are involved in nutrient uptake
have been demonstrated [29,30]. Thus it is likely that these specialized, leaf tissue colonizing
hyphae show dsRNA uptake that is superior over germ tubes.
Our data are consistent with reports showing that silencing signals in plants are mobile
[31,32]. The design of our experiments based on the previous finding that sRNAs, just as
viroids [33], preferably move via the vascular system in the source-to-sink direction although
some reports discussed transport in the opposite route (for review see [21]). Source-to-sink
movement is one reason why the phloem rather than the xylem is generally considered as the
conduit for movement of the silencing signal. This hypothesis is supported by the finding that
the xylem sap, which transports water and ions, commonly is free of RNA [34]. However,
spray application of dsRNA onto detached leaves cannot be compared with the situation in an
intact leaf. Exogenously applied dsRNA first reached the apoplast, including the xylem (Fig 5),
and subsequently translocated into the symplast by a yet unknownmechanism. Consistent
with this, we could also demonstrate acropetal movement of the silencing signal that resulted
in the inhibition of the fungus in distal not sprayed leaf areas (S3 Fig). Apoplastic movement of
RNA has been proposed, e.g. to explain how maternally expressed siRNAs could be transferred
from the endospermof developing seeds into the symplastically isolated embryo [35].
Regardless of how target-specific inhibitory RNAs are applied–by transgene delivery
(HIGS) or spray (SIGS)–the use of target-specific inhibitory RNAs to confer plant protection
potentially is an alternative to conventional chemicals because they are i) highly specific and
solely depending on their nucleotide sequence and ii) can be developed against an unlimited
range of pathogens provided that the RNAi machinery is in place. Given the accumulation of
dsRNA in the plant phloem (Fig 5), sucking insects also are realistic SIGS targets as their effi-
cient control by HIGS has been largely demonstrated [36,37]. Certainly, many questions have
to be addressed in the future to eventually judge the agronomical potential of SIGS, including
the costs of RNA applications and their stability under field conditions. Hence, more research
is required to develop application strategies, including improved uptake by compound design
and use of chemical formulations. Another yet unassessed issue is the risk that microbial strains
become insensitive to a commercial dsRNA product. Such scenario could probably be resolved
by application of dsRNA mixtures that target different regions in one gene or even different
genes. Moreover, a commercial dsRNA product should be designed not to have off-target
effects in other organisms that might be relevant in the respective agroecosystem, including
beneficial fungi and bacteria. In this respect, it is important to understand that both plants [12]
and fungi [38] support the production of secondary siRNAs, meaning there is a potential for
transitivity and amplification. It is therefore possible that low abundance inhibitory dsRNA
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 14 / 22
RNAi-Based Control of Fusarium graminearum
sprayed onto the plant triggered a large silencing effect in Fusarium via these secondaryRNAs.
Importantly, when considering the regulatory issue of RNA-based plant protection it is crucial
to emphasize that the principles of SIGS and HIGS rely on the mechanisms found for trans-
kingdom communication in mutualistic and parasitic interactions, and thus is a natural phe-
nomenon [12,13,14].
Apart from the dsRNAs prospects in future plant protection strategies, there is an additional
technological potential in developing new pesticides. The simple phenotyping adopted by the
SIGS screens renders them a powerful tool for genetic studies to assess compound targets with
high efficiency and low costs. Thus, the present data provide essential scientific information on
a fundamentally new plant protection strategy, thereby opening novel avenues for improving
crop yields in an environmentally friendly and sustainable manner.
Materials and Methods
Plant and fungal materials
The spring barley (Hordeum vulgare) cultivar (cv.) Golden Promise was grown in a climate
chamber under 16 h light photoperiod (240 μmol m-2 s-1 photon flux density) at 18°C/14°C
(day/night) and 65% relative humidity. The wild type Fusarium graminearum strain Fg-IFA65
was described earlier [20]. Plates were incubated at room temperature under constant illumina-
tion from one near-UV tube (Phillips TLD 36W/08) and one white-light tube (Phillips TLD
36W/830HF). Fungal strains were cultured on synthetic nutrient-poor agar (SNA)-medium
[39].
Generation of transgenic F. graminearum (Fg-IFA65GFP), expressing a jellyfish green fluo-
rescence protein (GFP) gene under theNeurospora crassa isocitrate lyase gene promoter (PCII)
[40], was performed as described [41].
For generation of theDICER LIKE-1 Fg-IFA65Δdcl-1 knock-outmutant, a homologous
recombination strategy was used. The two homologous recombination segments USS and DSS
(~1 kb each), representing promoter and termination regions of the FgDCL-1 gene, were
selected based on the sequence information available at the Fusarium graminearum genome
database (http://www.broadinstitute.org), and were PCR amplified. Primers used for USS
(DCL_1_USS_KpnI_F and DCL_1_USS_KpnI_R), and DSS (DCL_1_DSS_HindIII_F and
DCL_1_DSS_HindIII_R) are listed in S1 Table. The USS and DSS were cloned into flanking
sites of the hph cassette of the pPK2 binary vector [38] using USER enzymemix (New England
Biolab, Inc., Ipswich, MA, USA) in Escherichia coli. The resultant plasmid was confirmed for
proper orientation of cloned inserts in the vector by PCR conducted using USS/DSS and vec-
tor-specific primers and then by sequencing the PCR products.
The pPK2::ΔFgdcl-1 binary plasmid containing two Fgdcl-1USS and DSS was transformed
into Agrobacterium tumefaciens strain LBA4404 by electroporation, and transformants were
analyzed by conducting restriction analysis. The ATMT of F. graminearum was based on a
modifiedprotocol [42]. Briefly, A. tumefaciens LBA4404 containing the pPK2::ΔFgdcl-1 plas-
mid was grown overnight in LB medium at 28°C (25 μg mL-1 kanamycin, 25 μg mL-1 rifampi-
cin, and 5 μg mL-1 tetracycline). The next day, 10 ml of LB medium supplemented with above
mentioned antibiotics and 200 μM acetosyringone was inoculatedwith 100 μl of the A. tumefa-
ciens culture. This A. tumefaciens cell suspension with an OD600 of 0.5 to 0.7 was mixed with F.
graminearum conidial suspensions (105−106 mL-1) in liquid SNA medium in equal propor-
tions [1:1(v/v)]. Aliquots of 200 μl of the mixture were spread on black filter paper circles
(Grade 551; Whatman Inc., Piscataway, NJ, USA), which were overlaid on SNA plates contain-
ing 200 μM acetosyringone and incubated for 2 days in the dark at RT until mycelial growth
was observedon the filter paper. Transformants were selected on SNA medium supplemented
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 15 / 22
RNAi-Based Control of Fusarium graminearum
with 50 μg mL-1 of hygromycin B (Sigma, St. Louis, MO, USA) and 300 μg mL-1 ticarcillin
(Fisher Scientific, Pittsburgh, PA, USA).
dsRNA synthesis
The stacked clone (CYP51 B-A-C) [19] covering sequences of the three cytochrome P450 lanos-
terol C-14α-demethylase genes CYP51A (FGSG_04092),CYP51B (FGSG_01000), and CYP51C
(FGSG_11024) from F. graminearum was used as template for the synthesis of a 791 nt long
CYP3-dsRNA [19]. The pLH6000-Ubi::sGFPplasmid [43] was used as template for the synthe-
sis of a 720 nt long GFP-dsRNA (S1 Fig). dsRNA was generated usingMEGAscript RNAi Kit
(Invitrogen) followingMEGAscript protocols. Primer pairs T7_F and T7_R with T7 promoter
sequence at the 5`end of both forward and reverse primers were designed for amplification of
dsRNA (S1 Table).
sRNAs synthesis
sRNAs were generated using PowerCut Dicer (Thermo Scientific). Following the PowerCut
Dicer protocol, CYP3-dsRNA or GFP-dsRNA was used as template for Dicer cleavage.
Spray application
Detached leaf assay: Detached leaves of three-week-old barley plants were transferred into
square Petri dishes (120 x 120 x 17mm) containing 1% agar. For spray application, dsRNA was
diluted in 500 μL water to a final concentration of 20 ng μL-1, corresponding to 10 μg dsRNA
per plate. For sRNA application, the reactionmixture of DICER-cleaved dsRNA was used at a
final concentration of 10 μg siRNA diluted in 500 μL-1 water per plate. Leaves were sprayed
using a spray flask (10 mL capacity). Each dish containing six detached leaves was evenly
sprayed. For the semi-systemic setup, detached leaves were covered before spraying with a plas-
tic tray leaving only the upper part (approximately 1 cm) uncovered. After spraying, dishes
were kept open until the surface of each leaf was dried (approximately 2 h). After an indicated
lag time, leaves were drop-inoculatedwith 20 μL of 2 × 104 fungal conidia mL−1. Closed dishes
were incubated for 6 d at approximately 20°C on the lab bench. Alternatively, one-week-old
barley seedlingswere sprayed in the first leaf stage with 20 ng μL-1 dsRNA, and spray-inocu-
lated three weeks later with 2 × 104 conidia mL−1 of Fg-IFA65. Inoculated plants were grown
for three weeks in a growth chamber before evaluating the infection symptoms.
In vitro axenic cultures
Fg-IFA65 and Fg-IFA65Δdcl-1 were cultured on synthetic nutrient SNA-medium. Plates were
incubated at room temperature under constant illumination from one near-UV tube (Phillips
TLD 36W/08) and one white-light tube (Phillips TLD 36W/830HF). Conidia were harvested
from one-weak-old cultures with a sterile glass rod and sterile water [19]. CYP3-dsRNA was
added to the fungal samples. Plates were incubated at room temperature. Gene expression
studies were performed 24 h post CYP3-dsRNA treatment.
Quantification of fungal infection and transcript analysis
The relative amount of fungal DNA was measured using qPCR to quantify fungal infection.
DNA was extracted using the CTAB method [44]. Expression analysis of the three fungal
CYP51 genes as well as plant defense marker genes PR1 and JMT, respectively, was performed
using qPCR. RNA extraction from infected leaves was performedwith TRIzol (Invitrogen) fol-
lowing the manufacturer’s instructions. Freshly extractedmRNA was used for cDNA synthesis
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 16 / 22
RNAi-Based Control of Fusarium graminearum
using QuantiTect Reverse-Transcription kit (Qiagen). For qPCR 10 ng of cDNA was used as
template in the Applied Biosystems 7500 FAST realtime PCR system. Amplifications were per-
formed in 7.5 μL of SYBER green JumpStart Taq ReadyMix (Sigma-Aldrich)with 0.5 pmol oli-
gonucleotides. Each sample had three repetitions.
To quantify the amount of fungal DNA, primers were used for assessing expression of the
fungal β-tubulin gene (FGSG_09530) with reference to barley ubiquitin gene (S1 Table). Prim-
ers were used for assessing expression of target CYP51 genes with reference to β-tubulin gene
(S1 Table). After an initial activation step at 95°C for 5 min, 40 cycles (95°C for 30 sec, 57°C for
30 sec, 72°C for 30 sec) were performed. Ct values were determinedwith the 7500 Fast software
supplied with the instrument. Transcript levels of β -tubulin gene were determined via the 2-Δ
Δ Ct method [45] by normalizing the amount of target transcript to the amount of reference
transcript.
Small RNA library production and sequence analysis
RNA enriched for the sRNA fractionwas purified from plant and fungal samples using the
mirVana miRNA Isolation Kit (Life Technologies). Indexed sRNA libraries were constructed
from these enriched sRNA fractions with the NEBNext Multiplex Small RNA Library Prep Set
for Illumina (New England Biolabs) according to the manufacturer’s instructions. Indexed
sRNA libraries were pooled and sequenced on the Illumina HiSeq and NextSeq 500 platforms
and the sequences sorted into individual datasets based on the unique indices of each sRNA
library. The adapters and indices were trimmed using Trimmomatic [46] version 0.2.2 and the
reads were mapped to the CYP3-dsRNA vector sequence using bowtie2 [47] version 2.1.0. to
identify sRNAs with a perfectmatch. Each library contained at least 5 million total reads.
Northern blot analysis
For Northern blot analysis, 8 ng of total RNA from local region and 80 ng of systemic region or
negative control (TE-mock) and 10 pg of in vitro transcribedCYP3-dsRNA was loaded onto a
6% denaturing polyacrylamidegel with DNA MolecularWeight Marker VIII (Roche), trans-
ferred to a nylon membrane.CYP3-dsRNA and U2 snRNA were detected using the DIG Labeling
and Detection System (Roche) following the manufacturer’s instructions.Chemiluminescence
was detected using X-ray films.
The CYP3-dsRNA probe was created by PCR with CYP3-dsRNA forward and reverse
primer (S1 Table) on the stacked clone (CYP51 B-A-C) [19] using PCR DIG LabelingMix
(Roche). U2 snRNA loading control was amplified from cDNA created from total RNA using
qScript Flex cDNA Kit (Quanta BioSciences) and primers U2 forward (TACCTTTCTCGGC
CTTTTGGand U2 reverse (CAGCAGCAAGCTACTGTGGT). Gel purified probes were
hybridized in NorthernMax Prehybridization/Hybridization Buffer (Ambion) at 45°C over
night.
Northern blots for the detection of CYP3-dsRNA-derived siRNA were performed as
described [19] using a 791 nt [α-32P]-dCTP labeledCYP3-dsRNA as probe.
Confocal microscopy of fluorophore distribution
Twenty-four h after spraying fluorescing dsRNA were imaged using a Leica TCS SP2 (Leica
Microsystems,Wetzlar, Germany) equipped with a 75-mW argon/krypton laser (Omnichrome,
Chino, CA) and a water immersion objective (HCX APO L40x0.80WU-V-l objective). Fluo-
rescing dsRNA were imaged using a LSM 880 (ZeissMicroscopy GmbH, Jena, Germany) with
the 488 nm laser line of an argon multiline laser (11.5 mW) and a HeNe 594 nm (1.3 mW)
laser. Images were taken with a 20x objective (Plan-Apochromat 20x/0.8). Lambda stacks were
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 17 / 22
RNAi-Based Control of Fusarium graminearum
created using the 32 channel GaAsP detector. Reference spectra with each pure fluorescence dye
were recorded. The sample was inspected in Online Fingerprintingmode. Specific areas of the
sample were imaged in lambdamode followed by Linear Unmixing with ZEN software (Zeiss,
Jena, Germany). Fluorescent labeling of the dsRNA was performed using the Atto 488 RNA
LabelingKit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions. Leaves
were sprayed with the labeled dsRNA and 24 h later drop-inoculatedwith 2 × 104 Fg-IFA65
conidia mL−1. To assess whether dsRNA has an effect on fungal morphology, leaves were inocu-
lated with Fg-IFA65GFP and infected leaves were analyzed at 6 dpi.
For observation of phloem tissue, cortical cell layers were removed down to the phloem
from the lower side of the main vein of a mature leaf. The leaf surface and longitudinal- as well
as cross sections were stained with 4.3 μM of the membrane dye RH-414 (-N-(3-triethylammo-
niumpropyl)-4-(4-(4-(diethylamino)phenyl)butadienyl)pyridiniumdibromid) and/or with
5 μg mL-1 of the fungal hyphae dye wheat germ agglutinin (WGA) Alexa Fluor1 594 conjugate
(Invitrogen) for at least 10 min.
RH-414, WGA Alexa Fluor 594, and the autofluorescence of cell walls and chloroplasts
were excited by the 564-nm line of the argon/krypton laser, while GFP and ATTO 488 were
excited with the 488-nm line. For observation at the 590 nm and 510 nm wave lengths, respec-
tively, a long pass filter was used. Digital images were processedwith Adobe Photoshop to opti-
mize brightness, contrast, and color and to enable an overlay of the photomicrographs.
Statistical analysis
Analyses were performed in SigmaPlot 12 (Systat Software) using Student´s t-tests after data
were tested for normality distribution (Shapiro-Wilk test).
Genes mentioned in the text
FgCYP51A (FGSG_04092); FgCYP51B (FGSG_01000); FgCYP51C (FGSG_11024); FgDCL1
(FGSG_09025); ß-tubulin (FGSG_09530);HvPR1 (X74940);HvJMT (BAD33074.1);HvUBQ
(M60175)
Supporting Information
S1 Fig. Partial DNA sequence of jellyfish green fluorescent protein (GFP) from whichGFP-
dsRNA is derived (forward strand).
(TIF)
S2 Fig. SIGS-mediated control of F. graminearum on leaves sprayed withCYP3-dsRNA
(basipetal direction).Detached second leaves of three-week-old barley were locally sprayed
with 20 ng μL-1 CYP3-dsRNA, TE (mock control), and GFP-dsRNA (negative control), respec-
tively. After 48 h, leaves were drop-inoculated at the non-sprayed distal area (systemic; basipe-
tal direction) with 2 × 104 conidia mL−1 of Fg-IFA65 and evaluated for necrotic lesions at 6 dpi.
(TIF)
S3 Fig. SIGS-mediated systemic control of Fusarium graminearum (acropetal direction).
(A) Lower parts of detached second leaves of three-week-old barley were sprayed evenly with
CYP3-dsRNA and TE, respectively. After 48 h, the non-sprayed, distal (acropetal direction) tis-
sue was drop inoculatedwith 2 × 104 conidia mL−1 of Fg-IFA65GFP. (B)Macroscopy of fungal
growth at distal sites of drop-inoculationwith Fg-IFA65GFP. Stronger fungal colonization was
seen on TE-sprayed leaves. Photographs were taken at 6 dpi. (C) The relative amount of fungal
DNA in distal tissue as measured by qPCR at 6 dpi, was reduced in CYP3-dsRNA-treated
leaves. Bars represent mean values ± SDs of two independent experiments. The reduction of
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 18 / 22
RNAi-Based Control of Fusarium graminearum
fungal growth on CYP3-dsRNA-sprayed leaves was statistically significant (P< 0.05; Student
´s t test).
(TIF)
S4 Fig. Biological activity of fluorescentATTO 488-labeledCYP3-dsRNAA488 on Fusarium
infections in the distal, semi-systemic (non-sprayed) tissue of barley second leaves at 6 dpi.
(A) F. graminearum infections are reduced in the distal tissue of leaves that received a 48 h pre-
treatment with CYP3-dsRNAA488 as compared to GFP-dsRNAA488 (control). (B)Quantification
of fungal infection by qPCR. (C)Gene-specificquantification of CYP51 transcripts by qPCR.
(TIF)
S5 Fig. Confocal laser scanningmicroscopy of ATTO 488-labeledCYP3-dsRNAA488 in
locally sprayed barley leaves. (A) Bright field microscopy of a fungal hyphae. (B)Hyphae
strongly accumulatedCYP3-dsRNAA488. (C)Hyphae stained with chitin-specific dye WGA-
Alexa Fluor 594 (red). (D)Merge of B and C. RNA signals in germinated conidia are marked
by arrow heads. Fungal infection hyphae (IF). Scale bars 10 μm.
(TIF)
S6 Fig. Comparative qPCR analysis of the expression of DICER-LIKE 1 in Fusarium grami-
nearumwild type Fg-IFA65 and the dcl-1 knock-outmutant Fg-IFA65Δdcl-1.
(TIF)
S7 Fig. CYP3-dsRNA-derived siRNAs are inducers of SIGS. (A,B)Detached second leaves of
three-week-old barley were sprayed with 20 ng μL-1 of CYP3-dsRNA-derived sRNA (CYP3-
siRNA) or GFP-dsRNA-derived sRNA (GFP-siRNA, control) (see online methods), and 48 h
later drop-inoculatedwith Fg-IFA65. Infection symptoms were evaluated at 6 dpi in the local
(sprayed) (A) and distal, semi-systemic (non-sprayed) tissue (B). (C) qPCR quantification of
fungal DNA in local and distal leaf tissues after spray-application of CYP3-siRNA or GFP-
dsRNA at 6 dpi. (D,E) Gene-specificquantification of CYP51 transcripts by qPCR in local (D)
and distal tissue (E) at 6 dpi. Bars represent mean values ± SDs of two independent experiments.
(TIF)
S8 Fig. Fg-IFA65Δdcl-1 is not compromised in SIGS when inoculateddirectly to the sprayed
leaf area. (A) Experimental design: Fusarium was drop-inoculated to the sprayed leaf area. (B)
Both the fungal dicer-like-1mutant Fg-IFA65Δdcl-1 and the wt strain (Fg-IFA65) were inhibited
by CYP3-dsRNA as compared to TE treatment. Photographs were taken at 6 dpi. (C)Quantifi-
cation of fungal DNA by qPCR analysis confirmed the macroscopic analysis. Bars represent
mean values ±SDs of two independent sample collections. The reduction of fungal growth in
samples treated with CYP3-dsRNA compared with mock-treated TE controls was statistically
significant (P< 0.05, P< 0.01; Student´s t test).
(TIF)
S1 Table. Primers used in this study.
(DOCX)
S2 Table. sRNAs mapped to the CYP3-dsRNA sequence.
(XLSX)
Acknowledgments
We thank P. Ganz for excellent technical assistance. C. Birkenstock, U. Schnepp and V. Weisel
for excellent plant cultivation.We also thank Dr. Jens Steinbrenner for assisting in microscopic
analyses.
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 19 / 22
RNAi-Based Control of Fusarium graminearum
Author Contributions
Conceptualization:AK KHK.
Data curation: LJ AG VC JM TM.
Formal analysis:AK AF LJ VC JM TM.
Funding acquisition:KHK TM.
Investigation: AK AF DB LW OR LL JJ EA.
Methodology:AK KHK.
Project administration:AK KHK.
Resources:KHKAG VC JM TM.
Software: LJ AG VC JM TM.
Supervision:AK KHK.
Validation: AK AF KHK.
Visualization: AK AF.
Writing – original draft:AK KHK.
Writing – review& editing:KHKAK.
References
1. FAO. FAO Statistical Yearbook. World Food and Agriculture. Part 3: Feeding the World (ISBN 978-92-
5-107396-4). Accessed from Food and Agriculture Organization of the United Nations website: http://
www.fao.org (2013)
2. Bai G, Shaner G. Management and resistance in wheat and barley to Fusarium head blight. Annu Rev
Phytopathol. 2004; 42:135–61. doi: 10.1146/annurev.phyto.42.040803.140340 PMID: 15283663
3. Broekaert N, Devreese M, De Baere S, De Backer P, Croubels S. Modified Fusarium mycotoxins
unmasked: From occurrence in cereals to animal and human excretion. Food Chem Toxicol. 2015;
80:17–31. doi: 10.1016/j.fct.2015.02.015 PMID: 25725190
4. Merhej J, Richard-Forget F, Barreau C. Regulation of trichothecene biosynthesis in Fusarium: Recent
advances and new insights. Appl Microbiol Biotechnol. 2011; (3: ):519–28. doi: 10.1007/s00253-011-
3397-x PMID: 21691790
5. Kazan K, Gardiner DM, Manners JM. On the trail of a cereal killer: recent advances in Fusarium grami-
nearum pathogenomics and host resistance. Mol Plant Pathol. 2012; 13(4):399–413. doi: 10.1111/j.
1364-3703.2011.00762.x PMID: 22098555
6. Kuck KH, Stenzel K, Vors JP (2012) Sterol biosynthesis inhibitors modern crop protection compounds
(pp. 761–805): Wiley-VCH Verlag.
7. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interfer-
ence by double-stranded RNA in Caenorhabditis elegans. Nature. 1998; 391(6669):806–11. doi: 10.
1038/35888 PMID: 9486653
8. Hamilton AJ, Baulcombe DC. A species of small antisense RNA in posttranscriptional gene silencing in
plants. Science. 1999; 286(5441):950–2. doi: 10.1126/science.286.5441.950 PMID: 10542148
9. Vaucheret H, Fagard M. Transcriptional gene silencing in plants: targets, inducers and regulators.
Trends Genet. 2001; 17(1):29–35. doi: 10.1016/S0168-9525(00)02166-1 PMID: 11163919
10. Castel SE, Martienssen RA. RNA interference in the nucleus: roles for small RNAs in transcription, epi-
genetics and beyond. Nat Rev Genet. 2013; 14(2):100–12. doi: 10.1038/nrg3355 PMID: 23329111
11. Tomilov AA, Tomilova NB, Wroblewski T, Michelmore R, Yoder JI. Trans-specific gene silencing
between host and parasitic plants. Plant J. 2008; 56:389–397 doi: 10.1111/j.1365-313X.2008.03613.x
PMID: 18643992
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 20 / 22
RNAi-Based Control of Fusarium graminearum
12. Baulcombe DC. VIGS, HIGS and FIGS: small RNA silencing in the interactions of viruses or filamen-
tous organisms with their plant hosts. Curr Opin Plant Biol. 2015; 26:141–146. doi: 10.1016/j.pbi.2015.
06.007 PMID: 26247121
13. Weiberg A, Bellinger M, Jin H. Conversations between kingdoms: small RNAs. Curr Opin Biotechnol.
2015; 32:207–15. doi: 10.1016/j.copbio.2014.12.025 PMID: 25622136
14. Knip M, Constantin ME, Thordal-Christensen H. Trans-kingdom cross-talk: Small RNAs on the move.
PLoS Genet. 2014; 10(9):e1004602. doi: 10.1371/journal.pgen.1004602 PMID: 25188222
15. Weiberg A, Wang M, Lin FM, Zhao H, Zhang Z, Kaloshian I, Huang HD, Jin H. Fungal small RNAs sup-
press plant immunity by hijacking host RNA interference pathways. Science. 2013; 342(6154):118–
23. doi: 10.1126/science.1239705 PMID: 24092744
16. Nowara D, Gay A, Lacomme C, Shaw J, Ridout C, Douchkov D, Hensel G, Kumlehn J, Schweizer P.
HIGS: Host-Induced Gene Silencing in the obligate biotrophic fungal pathogen Blumeria graminis.
Plant Cell. 2010; 22(9):3130–41. doi: 10.1105/tpc.110.077040 PMID: 20884801
17. Price DRG, Gatehouse JA. RNAi-mediated crop protection against insects. Trends Biotechnol. 2008;
26(7):393–400. doi: 10.1016/j.tibtech.2008.04.004 PMID: 18501983
18. Koch A, Kogel KH. New wind in the sails: improving the agronomic value of crop plants through RNAi-
mediated gene silencing. Plant Biotechnol J. 2014; 12(7):821–31. doi: 10.1111/pbi.12226 PMID:
25040343
19. Koch A, Kumar N, Weber L, Keller H, Imani J, Kogel KH. Host-induced gene silencing of cytochrome
P450 lanosterol C14α-demethylase-encoding genes confers strong resistance to Fusarium species.
Proc Natl Acad Sci U S A. 2013; 110(48):19324–9. doi: 10.1073/pnas.1306373110 PMID: 24218613
20. Jansen C, von Wettstein D, Schäfer W, Kogel KH, Felk A, Maier FJ. Infection patterns in barley and
wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium grami-
nearum. Proc Natl Acad Sci U S A. 2005; 102(46):16892–7. doi: 10.1073/pnas.0508467102 PMID:
16263921
21. Melnyk CW, Molnar A, Baulcombe DC. Intercellular and systemic movement of RNA silencing signals.
EMBO J. 2011; 30(17):3553–3563. PMCID: PMC3181474 doi: 10.1038/emboj.2011.274 PMID:
21878996
22. Dunoyer P, Melnyk C, Molnar A, Slotkin RK. Plant Mobile Small RNAs. Cold Spring Harb Perspect
Biol. 2013; 5(7):a017897. PMCID: PMC3685890 doi: 10.1101/cshperspect.a017897 PMID: 23818501
23. Pyott DE, Molnar A. Going mobile: Non-cell-autonomous small RNAs shape the genetic landscape of
plants. Plant Biotechnol J. 2015; 13(3):306–18. doi: 10.1111/pbi.12353 PMID: 25756494
24. Gantier MP, Williams BRG. The response of mammalian cells to double-stranded RNA. Cytokine
Growth Factor Rev. 2007; 18(5–6):363–71. doi: 10.1016/j.cytogfr.2007.06.016 PMID: 17698400
25. Karpala AJ, Dorant TJ, Bean AGD. Immune responses to dsRNA: Implications for gene silencing tech-
nologies. Immunol Cell Biol. 2005; 83(3):211–6. doi: 10.1111/j.1440-1711.2005.01331.x PMID:
15877597
26. Jones JDG, Dangl JL. The plant immune system. Nature. 2006; 444(7117):323–9. doi: 10.1038/
nature05286 PMID: 17108957
27. Schäfer P, Pfiffi S, Voll LM, Zajic D, Chandler PM, Waller F, Scholz U, Pons-Kühnemann J, Sonnewald
S, Sonnewald U, Kogel KH. Manipulation of plant innate immunity and gibberellin as factor of compati-
bility in the mutualistic association of barley roots with Piriformospora indica. Plant J. 2009; 59(3):461–
74. doi: 10.1111/j.1365-313X.2009.03887.x PMID: 19392709
28. Chen Y, Gao Q, Huang M, Liu Y, Liu Z, Liu X, Ma Z. Characterization of RNA silencing components in
the plant pathogenic fungus Fusarium graminearum. Scientific Reports. 2015; 5, article number:
12500. doi: 10.1038/srep12500 PMID: 26212591
29. El Gueddari NE, Rauchhaus U, Moerschbacher BM, Deising HB. Developmentally regulated conver-
sion of surface-exposed chitin to chitosan in cell walls of plant pathogenic fungi. New Phytol. 2002;
156:103–112. doi: 10.1046/j.1469-8137.2002.00487.x
30. Oliveira-Garcia E, Deising HB. Infection structure-specific expression of ß-1,3-glucan synthase is
essential for pathogenicity of Colletotrichum graminicola and evasion of ß-glucan–triggered immunity
in maize. Plant Cell. 2013; 25(6):2356–78. doi: 10.1105/tpc.112.103499 PMID: 23898035
31. Molnar A, Molnar A, Melnyk CW, Bassett A, Hardcastle TJ, Dunn R, Baulcombe DC. Small silencing
RNAs in plants are mobile and direct epigenetic modification in recipient cells. Science. 2010;
328:872–875. doi: 10.1126/science.1187959 PMID: 20413459
32. Lewsey MG, Hardcastle TJ, Melnyk CW, Molnar A, Valli A, Urich MA, Nery JR, Baulcombe DC, Ecker
JR. Mobile small RNAs regulate genome-wide DNA methylation. Proc Natl Acad Sci U S A. 2016; 113
(6): E801–E810. doi: 10.1073/pnas.1515072113 PMID: 26787884
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 21 / 22
RNAi-Based Control of Fusarium graminearum
33. Ding B. The Biology of Viroid-Host Interactions. Annual Review of Phytopathol. 2009; 47: 105–131.
doi: 10.1146/annurev-phyto-080508-081927 PMID: 19400635
34. Buhtz A, Springer F, Chappell L, Baulcombe DC, Kehr J. Identification and characterization of small
RNAs from the phloem of Brassica napus. Plant J. 2008; 53:739–749. doi: 10.1111/j.1365-313X.2007.
03368.x PMID: 18005229
35. Martienssen RA (2010) Heterochromatin, small RNA and post-fertilization dysgenesis in allopolyploid
and interploid hybrids of Arabidopsis. New Phytol. 2010; 186(1):46–53. doi: 10.1111/j.1469-8137.
2010.03193.x PMID: 20409176
36. Abdellatef E, Will T, Koch A, Imani J, Vilcinskas A, Kogel KH. Silencing the expression of the salivary
sheath protein causes transgenerational feeding suppression in the aphid Sitobion avenae. Plant Bio-
tech. J. 2015; 13:849–857. doi: 10.1111/pbi.12322
37. Eamens A, Wang MB, Smith NA, Waterhouse PM. RNA silencing in plants: yesterday, today, and
tomorrow. Plant Physiol. 2008; 147(2):456–68. doi: 10.1104/pp.108.117275 PMID: 18524877
38. Calo S, Nicolás FE, Vila A, Torres-Martı́nez S, Ruiz-Vázquez RM. Two distinct RNA-dependent RNA
polymerases are required for initiation and amplification of RNA silencing in the basal fungus Mucor cir-
cinelloides. Mol Microbiol. 2012; 83(2):379–94. doi: 10.1111/j.1365-2958.2011.07939.x PMID:
22141923
39. Koch A, Khalifa W, Langen G, Vilcinskas A, Kogel KH, Imani J. The antimicrobial peptide thanatin
reduces fungal infections in Arabidopsis. J. Phytopathol. 2012; 160:606–610. doi: 10.1111/j.1439-
0434.2012.01946.x
40. Horwitz BA, Sharon A, Lu SW, Ritter V, Sandrock TM, Yoder OC, Turgeon BG. A G protein alpha sub-
unit from Cochliobolus heterostrophus involved in mating and appressorium formation. Fungal Genet
Biol. 1999; 26(1):19–32. doi: 10.1006/fgbi.1998.1094 PMID: 10072317
41. Maier FJ, Malz S, Lösch AP, Lacour T, Schäfer W. Development of a highly efficient gene targeting
system for Fusarium graminearum using the disruption of a polyketide synthase gene as a visible
marker. FEMS Yeast Res. 2005; 5(6–7):653–62. doi: 10.1016/j.femsyr.2004.12.008 PMID: 15780665
42. Covert SF, Kappor P, Lee M, Briley A, Nairn CJ. Agrobacterium tumefaciens mediated transformation
of Fusarium circinatum. Mycol. Res. 2001; 105:259–264 doi: 10.1017/S0953756201003872
43. Imani J, Li L, Schäfer P, Kogel KH. STARTS–A stable root transformation system for rapid functional
analyses of proteins of the monocot model plant barley. Plant J. 2011; 67(4):726–35. doi: 10.1111/j.
1365-313X.2011.04620.x PMID: 21518054
44. Chen DH, Ronald PC. A rapid DNA minipreparation method suitable for AFLP and other PCR applica-
tions. Plant Mol Biol Rep. 1999; 17:53–57.
45. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR
and the 2(-Δ Δ C(T)). Methods. 2001; 25(4):402–8. doi: 10.1006/meth.2001.1262 PMID: 11846609
46. Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina Sequence Data. Bioinfor-
matics. 2014; 30(15):2114–20. doi: 10.1093/bioinformatics/btu170 PMID: 24695404
47. Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012; 9(4):357–9.
doi: 10.1038/nmeth.1923 PMID: 22388286
PLOS Pathogens | DOI:10.1371/journal.ppat.1005901 October 13, 2016 22 / 22