Formation of the Testicular Immunological Barrier through Immunomodulation and ZIP9 Androgen Signaling in Rat Sertoli Cells Inaugural Dissertation Submitted to the Faculty of Veterinary Medicine In partial fulfillment of the requirements for the PhD-Degree of the Faculties of Veterinary Medicine and Medicine of the Justus Liebig University Giessen Submitted by Hassan Kabbesh, Veterinarian from Damascus, Syria Giessen 2022 From the Institute of Veterinary Physiology and Biochemistry Director / Chairman: Prof. Dr. Martin Diener Of the faculty of Veterinary Medicine of the Justus Liebig University Giessen First Supervisor and Committee Member: Prof Dr. Georgios Scheiner-Bobis Second Supervisor and Committee Member: PD Dr. Lutz Konrad Committee Members: Prof. Dr. Christine Wrenzycki - PD. Dr. Joachim Weitzel Date of Doctoral Defense: 24.01.2023 3 Abbreviation: ABP: Androgen binding protein Akt: Protein kinase B AMH: Anti-Müllerian hormone AR: Androgen receptor ASMA: alpha smooth muscle actin ATF-1: Activating transcription factor-1 BCS: Bovine calf serum bp: Base pair BMP: Bone morphogenetic protein BSA: Bovine serum albumin BTB: Blood testis barrier cAMP: Cyclic adenosine monophosphate CAR: Coxsackievirus-adenovirus receptor CCL: C-C motif chemokine ligand CCR2: C-C chemokine receptor type 2 CD: Cluster of differentiation Cldn: Claudin CR: Conditional reprogramming c-Raf: Rapidly accelerated fibrosarcoma CREB: cAMP response element-binding protein Cxcl: C-X-C Motif Chemokine Ligand d: Day DAPI: 4′,6-diamidino-2-phenylindole DHT: Dihydrotestosterone DMEM/F-12: Dulbecco's modified eagle medium/nutrient mixture F-12 DMSO: Dimethyl sulfoxide DNA: Deoxyribonucleic acid DNase I: Deoxyribonuclease I DPBS: Dulbecco′s Phosphate Buffered Saline 4 DTT: 1,4-Dithiothreitol ECL: Enhanced chemiluminescence ECM: Extracellular matrix EDTA: Ethylenediaminetetraacetic acid ER: Endoplasmic reticulum Erk1/2: Extracellular signal-regulated kinases 1 and 2 FACS: Fluorescence activated cell sorting FCS: fetal calf serum Fig: Figure FITC: Fluorescein isothiocyanate FSH: Follicle stimulating hormone g: Gradual gravitation GATA1: Erythroid transcription factor 1 GnRH: Gonadotropin releasing hormone Gnα11: G protein α11 GPCR: G-Protein coupled receptor hr: Hour IFN- γ: Interferon gamma IGF-1: Insulin-like growth factor 1 IL: Interleukin ITS: Insulin transferrin selenium JAM: Junction adhesion molecule KDa: kilo Dalton LCs: Leydig cells LH: Luteinizing hormone LPS: Lipopolysaccharide M: Macrophages MAPK: Mitogen-activated protein kinase M-CSF: Macrophage colony stimulating factor MCP1: Macrophage chemoattractant protein 1 5 MG: Matrigel mRNA: Messenger RNA mL: Milliliter nc-siRNA: negative control siRNA ng: Nanogram nM: Nanomolar NO: Number OD: Optical density P: Passage P450scc: Cytochrome P450 side-chain cleavage enzyme PA: Plasminogen activator PASC1: Primary adult rat Sertoli cells-1 PBS: Phosphate Buffered Saline PCR: polymerase chain reaction PCs: Peritubular cells PI3K: Phosphatidylinositol 3-kinase PKA: Protein kinase A PKC: Protein kinase C PMSF: Phenylmethyl sulfonyl fluoride P/S: Penicillin streptomycin qRT-PCR: quantitative real time polymerase chain reaction Raf: proto-oncogene serine/threonine-protein kinase Ras: sarcoma protein kinase RBDM: Rat blood derived monocytes RNA: Ribonucleic acid Rock inhibitor: Rho kinase inhibitor RT: Room temperature SCO: Sertoli cell only syndrome SCs: Sertoli cells SDS: Sodium dodecyl sulfate 6 SEM: Standard error of the mean Ser: Serine siRNA: small interfering RNA SOX9: SRY-Box transcription factor 9 Src: Proto-oncogene sarcoma protein T: Testosterone T-BSA-FITC: Testosterone-conjugated bovine serum albumin-labeled fluorescein isothiocyanate TDA: Tracer diffusion assay TEMED: Tetramethylethylenediamine TER: Transepithelial electrical resistance TGF-β: Transforming growth factor-beta TIB: Testicular immunological barrier TM: Testicular macrophages TNF-α: Tumor necrosis factor-alpha µg: Microgram µm: Micrometer µM: Micromolar WB: Western blots ZIP9: a zinc transporter from the family ZRT/IRT-like protein 9 (ZRT=zinc-regulated transporter; IRT=iron-regulated transporter) ZO: Zonula occludens HSD17β3: Hydroxysteroid dehydrogenase 17 beta3 7 Table of Contents 1 Introduction ................................................................................................................... 14 1.1 The male reproductive tract .......................................................................................... 14 1.1.1 Function and anatomy of the testis ............................................................................. 14 1.1.2 Functions of peritubular cells (PCs) ............................................................................. 15 1.1.3 Structure and functions of Sertoli cells ........................................................................ 15 1.1.4 Spermatogenesis ....................................................................................................... 16 1.2 Formation and regulation of the blood testis barrier (BTB) .............................................. 17 Figure 2. Illustrative figure of the blood testis barrier. ....................................................... 18 1.3 The testis as an immune privileged organ ...................................................................... 20 1.3.1 Maintenance of the testicular immune privilege through structural elements and local immune tolerance ........................................................................................................................... 20 1.3.2 The role of testicular macrophages (TMs) and other local immune cells in testis immune privilege ............................................................................................................................ 21 1.4 Steroidogenesis and the production of male sex hormones............................................. 22 1.4.1 The classical and the non-classical pathway of androgen signaling in testis ................... 23 1.4.2 ZIP9 as a non-classical receptor of androgen signaling.................................................. 25 1.5 Aims of the study.......................................................................................................... 25 2 Materials and Methods ................................................................................................... 27 2.1 Chemicals and materials ............................................................................................... 27 2.1.1 Chemicals.................................................................................................................. 27 2.1.2 PCR Reagents ............................................................................................................ 29 2.1.3 Antibodies ................................................................................................................. 29 2.1.4 Cytokines and toxins .................................................................................................. 30 2.1.5 kits............................................................................................................................ 31 2.1.6 Enzymes .................................................................................................................... 31 2.1.7 Primers ..................................................................................................................... 31 2.1.8 Cell culture reagents .................................................................................................. 33 2.1.9 siRNA transfection reagents ....................................................................................... 34 2.1.10 siRNA sequences...................................................................................................... 34 2.1.11 Equipments ............................................................................................................. 34 2.1.12 Miscellaneous.......................................................................................................... 35 2.2 Buffer solutions and reagent used for western blot ........................................................ 36 2.2.1 Western blots buffers ................................................................................................ 36 2.3 Cell culture................................................................................................................... 37 2.3.1 93RS2 Sertoli cells ...................................................................................................... 37 8 2.3.2 Irradiation of 3T3-J2 mouse fibroblast and preparation of conditioned medium (CM) .... 37 2.4 Animals........................................................................................................................ 38 2.5 Isolation of primary adult rat Sertoli cells and PCs .......................................................... 38 2.5.1 Isolation of primary adult rat Sertoli cells and PCs using enzymatic digestion ................ 38 2.5.2 Conditional reprogramming of primary adult rat Sertolie cells by culturing freshly isolated SC clusters with CM ................................................................................................................ 39 2.6 Isolation of rat blood-derived-monocytes (RBDM), purity assessment and polarization toward M0, M1 and M2 macrophages ................................................................................................... 40 2.6.1 Isolation and purity assessment of RBDM.................................................................... 40 2.6.2 Differentiation of RBDM into M0 macrophages and polarization into M1 and M2 macrophages ......................................................................................................................................... 40 2.7 Immunofluorescence .................................................................................................... 41 2.8 RNA extraction, RT-PCR and quantitative real time PCR .................................................. 42 2.8.1 RNA Isolation............................................................................................................. 42 2.8.2 DNase digestion......................................................................................................... 42 2.8.3 DNase digestion reaction mix: .................................................................................... 42 2.8.4 cDNA synthesis .......................................................................................................... 43 2.8.5 Denaturation of RNA and primer annealing: ................................................................ 43 2.8.6 RT mix: ...................................................................................................................... 44 2.8.7 RT-PCR ...................................................................................................................... 44 2.8.8 Quantitative real-time PCR (qRT-PCR) ......................................................................... 44 2.9 Transmigration assay of macrophages ........................................................................... 45 2.10 Measurement of transepithelial resistance (TER) .......................................................... 46 2.11 Tracer diffusion assay (TDA) ........................................................................................ 46 2.12 Silencing expression of ZIP9 or AR via siRNA ................................................................. 47 2.13 Plasma membrane labeling with testosterone-BSA-FITC................................................ 47 2.14. Treatments and sample preparations for western blots (WB) ....................................... 48 2.14.1 Preparation of cell lysates from PASC1 ...................................................................... 48 2.14.2 SDS-polyacrylamide gel electrophoresis .................................................................... 48 2.14.3 Western blotting...................................................................................................... 49 2.14.4 Reprobing of the membrane..................................................................................... 50 2.15 Statistical analysis ....................................................................................................... 50 3 Results ........................................................................................................................... 51 3.1.1 Isolation, characterization and purity assessment of adult rat Sertoli cells ..................... 51 3.1.2 Characterization of PASC1 and expression of testicular markers ................................... 56 3.1.3 Formation of the SC barrier to a functional characterize PASC1 .................................... 59 3.1.4 Expression of the androgen receptor (AR) in PASC1 ..................................................... 60 9 3.1.5 Effects of T on PASC1 barrier integrity ......................................................................... 61 3.1.6 Effects of T on the tight junction proteins zonula occludens-1 (ZO-1) and junctional adhesion molecule (JAM-3) ............................................................................................................... 62 3.1.7 Effects of different cytokines on the TJ barrier of PASC1............................................... 64 3.2 Characterization of the testicular immunological barrier (TIB) formed between PASC1 ..... 65 3.2.1 Isolation and characterization of rat blood-derived-monocytes (RBDM) ........................ 65 3.2.2 Characterization of M0, M1, and M2 after polarization ................................................ 69 3.2.3 The role of macrophage chemoattractant protein-1 (MCP1) in the transmigration assay 70 3.2.4 Transmigration assay of macrophages through testicular cells ...................................... 70 3.2.5 Influence of cytokines on macrophage transmigration through the testicular barrier formed between PASC1 ................................................................................................................. 72 3.3 Contribution of the classical AR or Zrt- and Irt-like protein 9 ZIP9 on TJ formation between PASC1 cells................................................................................................................................... 74 3.3.1 Silencing AR or ZIP9 expression by siRNA to investigate their role in androgen signaling 74 3.3.2 Investigation of the responsiveness of the PASC1 AR towards T or towards the ZIP9-targeting androgenic tetrapeptide IAPG............................................................................................. 76 3.3.3 Binding of the IAPG peptide or of T to the androgen binding site of ZIP9 ....................... 77 3.3.4 Stimulation of Erk1/2 phosphorylation by T or IAPG..................................................... 79 3.3.5 Identification of the receptor for androgen involved in Erk1/2 phosphorylation ............ 80 3.3.6 Involvement of AR or ZIP9 in stimulation of CREB/ATF-1 phosphorylation by T or IAPG .. 82 3.3.7 Involvement of AR or ZiP9 in stimulation of ZO-1 expression by T or IAPG ..................... 84 3.3.8 Participation of AR or ZIP9 in stimulation of Cldn-1 and JAM-3 expression by T or IAPG . 85 3.3.9 Investigation of the involvement of AR or ZIP9 in T- or lAPG-induced TJ formation ........ 87 4 Discussion ...................................................................................................................... 89 4.1 Isolation and characterization of the primary adult rat Sertoli cell line-1 (PASC1) ............. 89 4.2 Establishment and characterization of the TJ barrier formed between PASC1 .................. 91 4.3 Effects of some testicular cytokines on the TJ barrier of PASC1........................................ 91 4.4 Studying the TJ barrier between PASC1 from an immunological aspect ............................ 92 4.5 Effects of different testicular cytokines on transmigration of macrophages through the TJ barrier between PASC1 ................................................................................................................. 94 4.6 Investigation of the involvement of the classical AR or ZIP9 in androgen signaling and TJ formation in PASC1 ............................................................................................................................ 95 4.7 Investigation of the involvement of either the classical AR or ZIP9 in PASC1 androgen signaling in stimulation of Cldn-1 or JAM-3 and of the TJ integrity .......................................................... 96 4.8 ZIP9, the non-classical androgen receptor and its future therapeutic application.............. 98 4.9 Conclusion ................................................................................................................... 99 5 Summary .......................................................................................................................101 6 Zusammenfassung .........................................................................................................102 10 7 References ....................................................................................................................104 8 Acknowledgements .......................................................................................................125 9 Declaration ....................................................................................................................126 10 Erklärung .....................................................................................................................126 11 Own publications .........................................................................................................127 11 List of figures: Figure 1. The stages of spermatogenesis are illustrated. ................................................. 17 Figure 2. Illustrative figure of the blood testis barrier..................................................... 18 Figure 3. Schematic overview of the hypothalamic pituitary gonadal axis in males. ..... 23 Figure 4. The classical and the non-classical signaling pathway of T. ........................... 24 Figure 5. Brightfield microscopic photos of freshly isolated SCs. ................................. 52 Figure 6. Comparison of freshly isolated SC clusters with complete CM compared to complete DMEM/F12 in collagen-coated flasks. ............................................................ 53 Figure 7. Overview of the CR method for the isolation of adult rat SCs. ....................... 56 Figure 8. Immunofluorescence staining of PASC1 against SOX9, ASMA or both........ 57 Figure 9. qRT-PCR analysis of mRNA expression of SC-specific and/or -maturation markers in PASC1. ........................................................................................................................ 59 Figure 10. Time-dependent effects on the barrier integrity of SCs and PCs in mono-or co- cultures. ........................................................................................................................... 59 Figure 11. Conditionally reprogrammed PASC1 express the androgen receptor (AR) on the protein (A–D) and mRNA level (A) in passages P4 and P16. ........................................ 61 Figure 12. Time-dependent effects of T on the PASC1 TJ barrier. ................................ 62 Figure 13. Effects of T on JAM-3 mRNA expression and protein presence. ................. 63 Figure 14. Effects of T on ZO-1 mRNA expression (A) and protein presence (B–D). .. 64 Figure 15. Effects of IL-6, BMP2 or TGF-β3 on barrier integrity of PASC1................. 65 Figure 16. Morphology and characterization of RBDM with CD68 and TNF-α mRNA.67 Figure 17. Overview of the isolation of RBDM, their differentiation, and polarization into M0, M1, and M2 macrophages. .............................................................................................. 68 Figure 18. Expression of macrophage-specific genes after polarization analyzed with qRT- PCR. ................................................................................................................................ 69 Figure 19. Concentration-dependent effects of MCP1 as macrophage chemoattractant in the transmigration assay. ....................................................................................................... 70 Figure 20. Transmigration of macrophages M0, M1 and M2 through a barrier of PASC1 or PC, alone or both with or without matrigel (MG). .......................................................... 71 Figure 21. Characterization of PASC1 transmigration after treatment with different cytokines. ......................................................................................................................................... 73 Figure 22. Detection of AR mRNA or protein in PASC1 cells. ..................................... 75 Figure 23. Detection of ZIP9 mRNA or protein in PASC1 cells. ................................... 76 Figure 24. Localization of AR in PASC1 cells with T or IAPG treatment. .................... 77 12 Figure 25. Testosterone-BSA-FITC (T-BSA-FITC) membrane labeling of PASC1 cells.78 Figure 26. Western blot analysis of phospho-Erk1/2 after stimulation of PASC1 cells with various concentrations of T or IAPG for 24 hrs. ............................................................. 80 Figure 27. Immunofluorescence of phospho-Erk1/2 in PASC1 cells. ............................ 81 Figure 28. Immunofluorescence of p-CREB/p-ATF-1. .................................................. 83 Figure 29. Immunofluorescence of ZO-1 expression in PASC1..................................... 85 Figure 30. Detection of Cldn-1 by immunofluorescence. ............................................... 86 Figure 31. Detection of JAM-3-specific mRNA by qRT-PCR. ...................................... 87 Figure 32. Transepithelial electrical resistance (TER) across adult Sertoli cell layers. .. 88 13 List of tables: Table 1: Chemicals .......................................................................................................... 27 Table 2: Standard PCR and qRT-PCR reagents .............................................................. 29 Table 3: Primary antibodies used for immunofluorescence (IF) and western blots (WB)29 Table 4: Secondary antibodies used for IF or WB .......................................................... 30 Table 5: Chemokines, cytokines and toxins .................................................................... 30 Table 6: Kits .................................................................................................................... 31 Table 7: Enzymes ............................................................................................................ 31 Table 8: List of primer sequences used for Standard PCR or qRT-PCR ........................ 32 Table 9: List cell culture reagents ................................................................................... 33 Table 10: List of transfection reagents ............................................................................ 34 Table 11: List of siRNA sequences ................................................................................. 34 Table 12: List of equipments ........................................................................................... 34 Table 13: List of Miscellaneous ...................................................................................... 35 Table 14: Western blot buffers ........................................................................................ 36 Table 15: DNase digestion reaction mixture ................................................................... 42 Table 16: RNA mix ......................................................................................................... 43 Table 17: RT mix ............................................................................................................ 44 Table 18: qRT-PCR MIX ................................................................................................ 45 Table 19: Separating gel, SDS –PAGE gel preparation. ................................................. 48 Table 20: Stacking Gel .................................................................................................... 49 14 1 Introduction 1.1 The male reproductive tract All living beings undergo reproduction through which they produce progeny. The male reproductive system of humans and rodents consists of the penis, urethra, seminal vesicles, vas deferens, epididymis, testis and accessory glands (prostate). The main function of the male reproductive system is to sustain the continuous production and the transport of sperms in addition to the synthesis of sex hormones (Bilinska, 2006; Hedger & Hals, 2006). 1.1.1 Function and anatomy of the testis Testes are oval shaped, paired, descended outside of the abdominal cavity and are located inside the scrotum, as it is outside of the body; the temperature is slightly lower from the core temperature (Cooper, 2007; Nieschlag et al., 2010). The primary function of the histologically and functionally compartmented testis is to generate sperms and produce androgens, especially testosterone. Spermatogenesis takes place in the seminiferous tubules, whereas testosterone (T) synthesis occurs in the interstitium by Leydig cells which are located between the testis seminiferous tubules. The tubules are surrounded by a lamina propria, which contains 3 parts: a basal membrane, collagens and peritubular cells (PCs). PCs form a structural support and transport the immotile spermatozoa by generating a peristaltic motion through contractions along the tubules (Fijak & Meinhardt, 2006; de Krester et al., 2016). In men, several layers of PCs together with the extracellular matrix (ECM) proteins are forming the wall of the tubules (Mayerhofer, 2013). The germinal epithelium is the epithelial layer of the seminiferous tubules of the testis and it consists of different stages of germ cells: primarily spermatogonia, primary and secondary spermatocytes, spermatids and spermatozoa which are all located within invaginations of Sertoli cells (SCs). SCs are also called the nursery cells as they provide structural support, nutrients and different growth factors to the developing germ cells in addition to their other trophic functions. The progressively maturation of spermatogonia occurs as spermatocytes go through meiosis and transit to haploid spermatozoa and advance from the base toward the lumen of the tubules continuously while they are surrounded by SC cytoplasmic protrusions (Petersen & Soder, 2006). 15 The interstitial space consists of various types of cells like fibroblasts, Leydig cells, and different kinds of immune cells like T cells, testicular macrophages and few B cells and mast cells, which protect the microenvironment of the tubules against pathogens and sustain adequate conditions to support spermatogenesis (Loveland et al., 2017; Hedger, 1997; Heffner & Schust, 2010). 1.1.2 Functions of peritubular cells (PCs) PCs are smooth muscle-like cells with a spindle-shaped morphology and are surrounding the seminiferous tubules. In addition to SCs, they secrete ECM components. The peristaltic waves resulting from PC contractions and relaxations are vital for the successful transportation of the immotile spermatozoa along the lumen, which show clearly their inevitable role in spermatogenesis and hence, male fertility (Welsh et al., 2009; Welter et al., 2013). PCs express alpha-smooth muscle actin (ASMA), a contractile protein responsible for the movement of PCs. It is also used as a specific marker of these kind of cells (Schell et al., 2010). In cases with diminished spermatogenesis resulting from abnormalities in the testis like Sertoli cell only syndrome (SCO) or mixed atrophy, the accompanied infertility is usually associated with increased secretion of ECM proteins resulting in a fibrotic process in the seminiferous tubules wall in addition to changes in the PC layers (Welter et al., 2013). Previous investigations revealed more abnormalities in the morphology of the nucleus of the PCs, the cell size, faint staining of actin as well as an increase of vimentin staining associated with tubular sclerosis (Welter et al., 2013). 1.1.3 Structure and functions of Sertoli cells The early appearance of SCs in the gonad initiates the first developmental stages of the testis as they express the SRY gene, which determines sexual differentiation. Sertoli cells produce various substances that are important for male physiology such as ceruloplasmin, plasminogen activator (PA), transforming growth factors a & B (TGF-a & TGF-B), insulin- like growth factor (IGF-I) and various hormones like inhibin, anti-Mullerian hormone (AMH) and androgen binding protein (ABP) (Holstein et al., 2003). AMH produced solely in SCs suppresses the development of the female gonads (Holstein et al., 2003; Petersen & Soder, 2006). 16 Immature and mature SCs are different from each other in both morphological and biochemical aspects. At puberty, SCs become elongated, establish the TJs and secrete the seminiferous fluid, which allow lumen formation. At puberty, SC lose their ability to proliferate and they begin to express a new pattern of proteins e.g., transferrin and the inflammatory cytokine interleukin-1a (IL-1a) (Holstein et al., 2003; Petersen & Soder, 2006). SC form an epithelium which encloses the various stages of spermatocytes and forms a centrally located seminiferous tubule. Tight junctions (TJs) formed between SCs divide the seminiferous tubules into a basal and an adluminal compartment and form the blood testis barrier (BTB) (Holstein et al., 2003). 1.1.4 Spermatogenesis Spermatogenesis is a complicated process comprised of three main stages: mitotic proliferation which increases cell numbers; meiotic division resulting in genetic diversity; and spermiogenesis, which involves extensive reshaping to allow swimming and penetration of the egg by the sperm (Heffner & Schust, 2010). Before puberty, the spermatogonial stem cells are dormant. At puberty, they start developing on two different aspects: they increase their numbers through mitotic division; then they differentiate into spermatogonia type A/B, which go through meiotic divisions before they differentiate into primary spermatocytes. The first meiotic division leads to secondary spermatocytes and the second mitotic division results in the spermatids (de Krester et al., 1998). Finally, the round spermatids undergo a transformation to a microtubule-base tailed sperm with a head rich with chromatin and an anterior acrosome, which releases lytic enzymes during oocyte fertilization. By the end of this process, most of the spermatid cytoplasm is removed (de Krester et al., 1998; Fijak & Meinhardt, 2006; Heffner & Schust, 2010; Fig. 1). 17 Figure 1. The stages of spermatogenesis are illustrated. A diagram summarizing the stages of meiosis during spermatogenesis. (Figure http://iceteazegeg.wordpress.com/2009/02/25/gametogenesis/spermatogenesis/). 1.2 Formation and regulation of the blood testis barrier (BTB) The BTB is formed between SCs and it separates the advanced meiotic and post-meiotic germ cells from the immune system. It is a dynamic structure that allows the passage of the various stages of ) germ cells from the adluminal to the luminal compartment. At the same time, the formation of TJ at the BTB restrict the uncontrolled paracellular flow of water and nutrients across the SC epithelia and protect at the same time the developing haploid forms of male germ cells by establishing an immune-privileged environment Impairments of the BTB causes infertility in men (Mruk & Cheng, 2015). http://iceteazegeg.wordpress.com/2009/02/25/gametogenesis/spermatogenesis/ 18 The BTB is formed and maintained by the establishment of TJs located between SCs. TJs are mainly formed by interactions of occludin with claudins (Cldn), which in turn associate with signaling proteins and proteins of the cytoskeleton inside the cell membrane (Mruk & Cheng, 2004; Morrow et al., 2010; Cheng & Mruk, 2012; Fig.2). Figure 2. Illustrative figure of the blood testis barrier. The BTB is located near the tunica propria and is formed between Sertoli cells (SCs). It divides the seminiferous tubules into apical and basal compartments. Spermatogonial cell division and differentiation to preleptotene spermatocytes occur in the basal compartment, whereas meiosis, spermiogenesis and spermiation happens in the apical compartment (Figure taken from Gao et al., 2020). Numerous fundamental tight junction proteins were described among SCs; these include the Cldn family, Cldn-1, -3, -5, -11, -12 and -13 (Gow et al., 1999; Morrow et al., 2009; 2010; 19 Komljenovic et al., 2009; Haverfield et al., 2013; Chakraborty et al., 2014; Dietze et al., 2015), occludin (Moroi et al., 1998), the junctional adhesion molecule (JAM) family (Gliki et al., 2004), tricellulin (Smith & Braun, 2012) and coxsackievirus and adenovirus receptor (CAR) (Su et al., 2012). These proteins bind to the actin cytoskeleton via cytoplasmic plaque proteins including zonula occludens-1, -2 and -3 (ZO-1, ZO-2 and ZO-3) and provide links to the other different types of junctions (gap- , adherens-) in the BTB (Mruk & Cheng, 2015). There are numerous studies implementing the importance of the Cldns in the establishment of TJs. For instance, mice with Cldn-1 deficiency die shortly after birth because of dehydration resulting from disruption of many blood-tissue barriers (Furuse et al., 2002). Cldn-2 has also a vital role in the establishment of TJs in the proximal tubule in kidneys (Muto et al., 2010), and Cldn-5 is important in the establishment of the blood-brain barrier (Nitta et al., 2003). Among all types of Cldns, it appears that only Cldn-11 is pivotal for spermatogenesis as inactivation of Cldn-11 protein causes infertility as spermatogenesis does not proceed beyond spermatocytes (Mazaud-Guittot et al., 2011; Gow et al., 1999), whereas Cldn-3, CAR and JAM-A knockouts are fertile with no testicular phenotype (Cera et al., 2004; Chakraborty et al., 2014). Cldn-11 was also proven to be present in high levels in rat, mouse and human testis (Morita et al., 1999; Fink et al., 2009; Dietze et al., 2015; Stammler et al., 2016), whereas occluden or Cldn-3 presence in human testis is still controversial (Moroi et al., 1998; Ilani et al., 2012). The role of Cldn-5 in spermatogenesis is unknown because the knockout causes post-natal death (Nitta et al., 2003). In rat testis, numerous Cldns were identified to participate in BTB formation (Furuse et al ., 1998; Morita et al., 1999a). The expression of Cldn-3 and Cldn-5 is highly increased at stage VIII of spermatogenesis in mice at day 20 post-partum, which suggests their importance in the formation of the BTB (Meng et al., 2005; Morrow et al., 2009). The expression of Cldn-1 also increases postnatally between days 16 and 35 until adulthood where it stops increasing (Yan et al., 2008). T is a key regulator of BTB dynamics (Meng et al, 2005; Morrow et al, 2010). It was also found to promote TJ formation between SCs by stimulating expression of Cldn-1 and Cldn- 11 (Gye, 2003; Florin et al., 2005). Cldn-3 was found to be dependent on signaling of the androgen receptor (AR) in Sertoli cell specific-knockout mice. Moreover, AR downregulation negatively affected testicular immune privilege (Meng et al., 2005; 2011). Nevertheless, it was never clear whether the T effects on the membrane-bound Cldns and on establishment of TJs 20 are mediated by the classical AR or through a G-protein coupled receptor (GPCR). Understanding this mechanism may open new concepts regarding causes of infertility and its treatment. 1.3 The testis as an immune privileged organ An immune privileged organ is characterized by its ability to tolerate certain events from causing an inflammatory immune response in the long term (Forrester et al., 2008). A number of immune privileged organs, other than the testis, have been described and include the centeral nervous system, the anterior chamber of the eye and tumor-draining lymph nodes (Fijak & Meinhardt, 2006; Mellor & Munn, 2008; Asano et al., 2015). These organs are believed to protect themselves from the immune system by inhibiting access of innate and adaptive immune cells to these sites (Benhar et al., 2012). Testicular immune privilege is critical to protect developing germ cells from the auto-immune attack of immune cells, as foreign antigens are expressed during spermatogenesis (Fijak & Meinhardt, 2006; Arck et al., 2014; Zhao et al., 2014). In specific pathological incidents, the testicular immune privilege is compromised. As a result, anti-sperm antibodies are produced in large quantities which may lead to infertility (Wenes et al., 2016). Numerous studies in the last decades have demonstrated that multiple mechanisms including the testicular immunological barrier (TIB), local immunosuppression and tolerance of the immune system are involved in testis immune privilege (Zhao et al., 2014; Bhushan & Meinhardt, 2017). 1.3.1 Maintenance of the testicular immune privilege through structural elements and local immune tolerance As previously mentioned, the BTB is formed between SCs and it divides the seminiferous tubules into basal and adluminal compartments, which separates the advanced germ cel ls form the immune system (Arck et al., 2014; Jiang et al., 2014). Moreover, SCs have also immunosuppressive characteristics by secreting specific factors including anti -inflammatory proteins like TGF-β1, complement factors and some proteinase inhibitors (Suarez-Pinzon et al., 2000; Sipione et al., 2006; Lee et al., 2007; Fallarino et al., 2009). SC co-transplantation studies revealed more facts about the SC immunosuppressive factors, where pancreatic islets 21 survived longer when applied together with SCs (Lan et al., 2001). Additionally, SC get rid of apoptotic germ cells and of the residual bodies of the spermatids, which may cause an inflammatory response and thus maintain normal spermatogenesis (Li at al., 2012; Zhao et al., 2014; Asano et al., 2015). Leydig cells are the largest cell population in the interstitial space, they secrete androgens which are pivotal for normal spermatogenesis and are also known to have anti-inflammatory characteristics (Fijak & Meinhardt, 2006; Zhao et al., 2014). Testosterone increases polarization of immature T cells to regulatory T cells and inhibit production of tumor necrosis factor-alpha (TNF-α) in SCs and PCs in case of inflammation (Fijak et al., 2015). Additionally, several studies have shown that T treatment stopped some auto-immune diseases like rheumatoid arthritis by suppression of local immune reactions (Cutolo, 2009). Furthermore, numerous clinical studies have demonstrated that T downregulated secretion of pro- inflammatory cytokines including TNF-α, interleukin-1 (IL-1) and interleukin-6 (IL-6). In contrast, secretion of anti-inflammatory cytokines like IL-10 was upregulated (Bhushan et al., 2015). Taken together, androgens maintain the testis immune privilege by suppressing the local immune reaction and inducing immune tolerance. 1.3.2 The role of testicular macrophages (TMs) and other local immune cells in testis immune privilege TMs are immune cells which are found in the interstitial space of the testis (Bhushan & Meinhardt, 2017). In contrast to macrophages found in other tissues, TMs have only a weak ability to secrete pro-inflammatory cytokines like TNF-α, concomitant with a strong secretion of anti-inflammatory cytokines like IL-10, which help to maintain the testis immune privilege (Bhushan et al., 2015). In normal conditions, 80% of TMs demonstrate an immunosuppressive M2 phenotype characterized by expression of CD-163, a marker of M2 macrophages (Meinhardt & Hedger, 2011; Winnall & Hedger, 2013; Bhushan & Meinhardt, 2017). Dendritic cells are also found in the testicular interstitial space and are known to play a vital role in the regulation of adaptive immune response (Guazzone et al., 2011). They can induce lymphocytes differentiation in response to antigens which reduces their immune response (Banchereau & Steinman, 1998; Rival et al., 2006). They are also found in huge numbers in the testis in post-experimental autoimmune orchitis (EAO) which indicates their role in suppressing inflammation (Rival et al., 2006). 22 Mast cells participate to the immune response against parasites and allergy (Hussein et al., 2005). They can also induce tissue fibrosis and sclerosis by activating fibroblast proliferation and collagen synthesis (Abe et al., 1998). Several studies have demonstrated that cases accompanied with abnormal spermatogenesis or infertility are associated with higher numbers of mast cells which caused fibrosis in testis later on (Jezek et al., 1999; Meineke et al., 2000; Fijak & Meinhardt, 2006). 1.4 Steroidogenesis and the production of male sex hormones Steroids are lipophilic compounds comprised of cholesterol and the two classes of its derivatives, the bile acids and the steroid hormones. Since cholesterol can be found in all cell membranes of animal cells, thus, they are involved in most of the physiological processes in the body (Silvius, 2003). Steroids help also to regulate and control immune responses, stress, bone and muscular metabolism and even mood (Coutinho & Chapman, 2011; Kuo et al., 2013; Carson & Manolagas, 2015; Sanjuan et al., 2016). Despite that cholesterol synthesis takes place in all animal cells, steroidogenesis (the production of steroid hormones), happens only in few organs: the adrenal cortex, the placenta and the gonads (New & White, 1995). The first enzymatic reaction in the mitochondria which catalyzes the conversion of cholesterol to pregnenolone is activated by the removal of the cholesterol side chain. After that, pregnenolone enters the endoplasmic reticulum (ER) for synthesis of either sex steroids or corticoids and becomes hydroxylated on Carbon-17 by P450scc to form 17α-hydroxy- pregnenolone or it gets converted to progesterone (Hall, 1985; Arukwe et al., 2008; Sewer & Li, 2008). The later processing of either of both leads to the synthesis of androgens and estrogens, T or 17β-estradiol. T is converted in the target tissue to the more active dihydrotestosterone (DHT) (Randall, 1994). Synthesis of sex hormones is regulated by the hypothalamus through pulsatile secretion of Gonadotropin-releasing hormone (GnRH), which stimulates the pituitary gland to release of luteinizing hormone (LH) and follicle stimulating hormone (FSH) (Drummond, 2006). In testis, expression of P450scc and thus pregnenolone synthesis is increased by stimulation of LH in Leydig cells. After puberty, this leads to increased synthesis of T by the continuous pulsatile release of GnRH and LH. FSH is essential in stimulating both LH receptor expression in Leydig cells and the production of androgen binding protein in SCs (Ramaswamy & Weinbauer, 2014; Fig. 3). 23 Figure 3. Schematic overview of the hypothalamic pituitary gonadal axis in males. LH and FSH are secreted from the pituitary gland (P) in response to GnRH secreted from hypothalamus (H). LH stimulates testosterone production and FSH stimulates expression of the androgen binding protein and also of LH receptors on Leydig cells. Feedback mechanism of testosterone helps to regulate secretion of GnRH and thus synthesis of LH and FSH. 1.4.1 The classical and the non-classical pathway of androgen signaling in testis T is primarily synthesized in Leydig cells in addition to small amounts produced in the adrenal glands. T serum concentration is age related (Kelsey et al., 2014). T acts via 2 different pathways, the classical and the non-classical pathway. In the classical pathway, T activates the cytosolic AR causing its translocation to the nucleus there it regulates protein biosynthesis by activating transcription factors (Mangelsdorf et al., 1995; Ochiai et al., 2004). The non- classical pathway is characterized by rapid events which lead to activation of cytosolic signaling cascades that are normally activated by growth factors such as the tyrosine kinases (Src)/phosphatidylinositol 3-kinase (PI3K)/ protein kinase B (Akt) and/or the Src/rat sarcoma protein kinase (Ras)/ proto-oncogene serine/threonine-protein kinase (Raf)/ extracellular signal-regulated protein kinase 1/2 (ERK1/2) cascade (Kato et al., 2000; Valverde & Parker, Male FSH LH Testis Testis Testosterone H P GnRH _ _ 24 2002). Nevertheless, the receptor involved in the non-classical signaling is still debeted. Some investigators even suggested that the cytosolic AR is involved in both the classical and the non-classical pathway of T signaling (Walker, 2010). Figure 4. The classical and the non-classical signaling pathway of T. The cytosolic and nuclear AR is involved in both testosterone signaling pathways in this model of Walker (2009). Others suggested a membrane-bound receptor of the family G-protein coupled receptor (GPCR) is a possible mediator of the non-classical pathway (Kampa et al., 2002; 2005; Estrada et al., 2003; Dambaki et al., 2005; Fu et al., 2012). Activation of ERK1/2 and other mitogen- activated protein kinase (MAPK) is also pivotal for spermatogenesis (Sette et al., 1999; Di Agostino et al., 2004). Non-classical action of T is essential for spermatogenesis and maturation of germ cells towards spermatozoa (Walker, 2010). Moreover, activation of cyclic AMP response element binding protein (CREB) in SCs which is vital for spermatocytes and spermatozoa production (Scobey et al., 2001), is triggered by T via the activation of the c-Src/c-RAF/ERK1/2 signaling cascade of the non-classical T signaling pathway (Rahman & Christian, 2007; Walker, 2010; 2011; Fig. 4). 25 1.4.2 ZIP9 as a non-classical receptor of androgen signaling Recent studies in our laboratory demonstrated that in spermatogenic GC-2 cells, the non- classical T signaling pathway is mediated by a membrane-bound protein interacting with the G-protein Gnα11 (Shihan et al., 2014). Further studies by other investigators in the same year indicated that the female Atlantic croaker ZIP9, a zinc transporter from the family ZRT/IRT- like protein (ZRT=zinc-regulated transporter; IRT=iron-regulated transporter) serves as a membrane-bound androgen receptor (Berg et al., 2014; Thomas et al., 2014). More findings in our laboratory revealed that the membrane-bound protein that interacts with Gnα11 as a mediator of the non-classical pathway of androgen signaling in GC-2 cells is ZIP9, and not the classical cytosolic AR (Shihan et al., 2015). More recent investigations have also revealed that ZIP9 is the sole mediator of the non-classical pathway of T represented by activation of ERK1/2, CREB and ATF-1 and regulation of TJs in the rat prepubertal Sertoli cell line 93RS2, which lacks AR expression (Bulldan et al., 2016). 1.5 Aims of the study Despite numerous studies performed to analyze the BTB in vitro, very few have been focused on its establishment, the key cell molecules of its formation or how the TIB can prevent the infiltration of the immune cells into the lumen of the seminiferous tubules. Moreover, most of the BTB studies performed using SCs from immature animals because of the easiness to achieve it. However, only very few studies were focused on studying the BTB between adult SCs with limited success regarding the isolation of adult SC or even establishing a functional barrier in vitro. T is the main player in all stages of testis development, it has pivotal role in spermatogenesis and tightening of the BTB to form an immune privileged environment in the testis. Recently published manuscripts demonstrated that the ZIP9 is the sole receptor to mediate the non-classical pathway of T signaling in immature rat SC, however, would it be also the same in case of adult rat SC? However, because the BTB formed by immature SCs is weak, thus we decided to start with adult SCs and the formation of the barrier by addressing the following aims: • Creating a successful isolation protocol of adult rat SCs in which the main characteristics of adult rat SCs are maintained in the long term. • Unveil the contribution SCs, PCs or co-culture of both cells to the integrity of the BTB. 26 • Achieving a tighter barrier in vitro between adult rat SCs by treatment with known testicular hormones or cytokines. • Establishment of a transmigration model with macrophages which might help us to understand the situation in vivo. • Study the effects of T on the BTB integrity and the mechanism of androgen signaling by testing both the classical and the non-classical pathway of androgen signaling to investigate whether ZIP9 or AR is the main mediator of androgen signaling in adult rat SCs by treatment of SCs with androgenic peptide designed to target ZIP9 only. 27 2 Materials and Methods 2.1 Chemicals and materials 2.1.1 Chemicals Table 1: Chemicals Chemicals Manufacturer City, Country Acetic acid Roth Karlsruhe, Germany Acrylamide 30% (w/v) Roth Karlsruhe, Germany Amphotericin B Sigma-Aldrich Steinheim, Germany Agarose Roth Karlsruhe, Germany Biotinylated protein ladder Cell signaling Leiden, Holland Calcium chloride (CaCl2) Merck Darmstadt, Germany Chloroform Merck Darmstadt, Germany Collagen I 354236 Corning Frickenhausen, Germany 4′,6-diamidino-2-phenylindole (DAPI) Invitrogen Karlsruhe, Germany DNA ladder (100 bp) Promega Mannheim, Germany Dimethyl sulfoxide (DMSO) Merck Darmstadt, Germany di-potassium hydrogen phosphate Merck Darmstadt, Germany di-sodium hydrogen phosphate Merck Darmstadt, Germany 1,4-Dithiothreitol (DTT) Roche Mannheim, Germany Ethanol Sigma-Aldrich Steinheim, Germany Ethylene diaminetetraacetic acid disodium salt (EDTA) Merck Darmstadt, Germany Fluorescein isothiocyanate conjugate (FITC) coupled dextran FD4 Sigma-Aldrich Steinheim, Germany Glycerol Merck Darmstadt, Germany Halt ™ protease inhibitor cocktail Thermo Scientific Frankfurt, Germany Hydrogen peroxide Roth Karlsruhe, Germany Glycine Sigma-Aldrich Steinheim, Germany Isofluran Abbott Wetzlar, Germany 28 4-(2-hydroxyethyl)-1-piperazineetha- Roth Karlsruhe, Germany nesulfonic acid Leukotracker ™ Cell biolabs San Diego, USA Lymphoprep gradient Stem cell Cologne, Germany Lysis buffer X10 Cell signaling Frankfurt, Germany Magnesium chloride (MgCl2) Merck Darmstadt, Germany Magnesium sulfate (MgSO4) Sigma-Aldrich Steinheim, Germany Matrigel (MG) Corning Frickenhausen, Germany β-Mercaptoethanol AppliChem Darmstadt, Germany Methanol Roth Karlsruhe, Germany Non-fat dry milk Bio-Rad München, Germany Paraformaldehyde Merck Darmstadt, Germany Pepstatin A Tocris Wiesbaden, Germany Percoll gradient Sigma-Aldrich Steinheim, Germany Phenylmethylsulfonyl fluoride (PMSF) Sigma-Aldrich Steinheim, Germany Ponceau S Roth Karlsruhe, Germany Protease inhibitor cocktail Roche Mannheim, Germany Rho kinase (ROCK) inhibitor Enzo life sciences Lörrach, Germany Sodium acetate Roth Karlsruhe, Germany Sodium azide Merck Darmstadt, Germany Sodium chloride Sigma-Aldrich Steinheim, Germany Sodium dodecyl sulfate (SDS) Merck Darmstadt, Germany N,N,N',N’-Tetramethylethylenediamin (TEMED) Roth Karlsruhe, Germany Tris (hydroxymethyl) Roth Karlsruhe, Germany aminomethane hydrocholride Triton X-100 Sigma-Aldrich Steinheim, Germany Trypan blue Dye, 0,4% Bio-rad Munchen, Germany Tween-20 Roth Karlsruhe, Germany Testosterone Sigma-Aldrich Steinheim, Germany 29 Testosterone 3-(O-carboxymethyl) oxime bovine serum albumin-fluorescein isothiocyanate conjugate (T-BSA-FITC) and BSA-FITC Sigma-Aldrich Steinheim, Germany 2.1.2 PCR Reagents Table 2: Standard PCR and qRT-PCR reagents Item Manufacturer City, Country DNase I Invitrogen Karlsruhe, Germany dNTPs Promega Mannheim, Germany iTaq universal SYBR green supermix Biorad Munich, Germany Oligo dT Promega Mannheim, Germany MMLV RT Promega Mannheim, Germany Nuclease-free water Qiagen Hilden, Germany Reverse Transcription-System first strand cDNA synthesis kit Invitrogen Karlsruhe, Germany Taq DNA polymerase Promega Mannheim, Germany Taq DNA Polymerase Bio&Sell Feucht, Germany 2.1.3 Antibodies Table 3: Primary antibodies used for immunofluorescence (IF) and western blots (WB) Primary Antibody Manufacturer Catalogue No. Dilution AR Santa Cruz SC-7305 1:300 IF ASMA DAKO M0851 1:300 IF Beta actin Cell Signaling 4970S 1:3000 WB CD68 Abcam ab283654 1:100 IF Claudin-1 Invitrogen 37-4900 1:300 IF JAM-3 Invitrogen AB_2533486 1:300 IF SOX9 Merck Millipore AB5535 1:300 IF 30 p-CREB Cell Signaling 9198S 1:300 IF p-Erk1/2 Cell Signaling 4370S 1:2000 WB 1:300 IF t-Erk1/2 Cell Signaling 9102S 1:1000 WB ZIP9 Thermo Fisher Sientific PA5-21074 1:300 IF ZO-1 Invitrogen 61-7300 1:300 IF Table 4: Secondary antibodies used for IF or WB 2.1.4 Cytokines and toxins Table 5: Chemokines, cytokines and toxins Name Manufacturer Catalogue Number Bone morphogenetic protein 2 (BMP2) Promokine C-67309 Cholera toxin Sigma-Aldrich C8052 Interleukin-6 (IL-6) Promokine D-61632 Lipopolysaccharide (LPS) Sigma-Aldrich L2630 Macrophage colony stimulating factor (M-CSF) Miltenyi Biotec 130-101-700 Recombinant interferon gamma (IFN-γ) Promocell C-60724 Secondary antibody Manufacturer Catalogue No. Dilution Alexafluor 488-conjugated donkey anti-rabbit Life Technologies A-21206 1:250 IF Alexafluor 488-conjugated donkey anti-mouse Life Technologies A-21202 1:250 IF Alexafluor 555-conjugated donkey anti-mouse Life Technologies A-31570 1:250 IF Donkey anti mouse IgG–HRP Cell signaling 7076S 1:2500 WB Goat anti rabbit IgG –HRP Cell signaling 7074S 1:2500 WB https://www.miltenyibiotec.com/DE-en/products/mouse-m-csf.html#copy-to-clipboard 31 Recombinant interleukin-4 (IL-4) Promocell C-61421 Recombinant interleukin-13 (IL-13) Promocell C-62312 Transforming growth factor beta-3 (TGF-β3) Promokine C-63508 Tumor necrosis factor-alpha (TNF-α) Promokine C-63719 2.1.5 kits Table 6: Kits Name Manufacturer Catalogue Number Cytoselect™ leukocyte transmigration assay kit (8 µm) Cell Biolabs CBA-212 Bicinchoninic acid protein assay reagent kit Thermofisher 23225 2.1.6 Enzymes Table 7: Enzymes Name Manufacturer City, country Collagenase type I Sigma-Aldrich Taufkirchen, Germany Hyaluronidase Sigma-Aldrich Taufkirchen, Germany Deoxyribonuclease I (DNASE I) Sigma-Aldrich Taufkirchen, Germany Trypsin Pan-Biotech Aidenbach, Germany 2.1.7 Primers All primers were designed with http://www.ncbi.nlm.nih.gov/tools/primer-blast (last accessed February 28, 2022) and were all intron-spanning (Table 8). 32 Table 8: List of primer sequences used for Standard PCR or qRT-PCR Genes (species) and acc. No Sequence (5'-3') Annealing temperature Size of PCR product (bp) AMH (rat) NM_012902.1 5' AACTGACCAATACCAGGGGC 3' 5' GGCTCCCATATCACTTCAGCC 3' 59°C 334 AR (rat) NM_012502.2 5' GCCAGTGGCTGAGGATGAG 3' 5' GGTGAGCTGGTAGAAGCGC 3' 59°C 236 CCL17 (rat) NM_057151.1 5' TGATGTCACTTCAGATGCTGC 3' 5' GGACAGTCTCAAACACGATGG 3’ 59°C 201 CCL22 (rat) NM_057203.1 5' AGGATGCTCTGGGTGAAGAA 3' 5' TAGGGTTTGCTGAGCCTTGT 3’ 59°C 98 Clusterin (rat) XM_039092999.1 5' AGGAGCTAAACGACTCGCT 3' 5' GCTTTTCCTGCGGTATTCC 3’ 59°C 362 CXCL11 (rat) NM_182952.2 5' GCAGCAATCAAGGAAGTTTCTG3' 5' CAGAAACTTCCTTGATTGCTGC 3’ 59°C 22 GAPDH (rat) XM_039107008.1 5' GACCCCTTCATTGACCTCAAC 3' 5' GATGACCTTGCCCACAGCCTT 3’ 59°C 561 GATA1 (rat) NM_012764.2 5' ATAGCAAGACGGCGCTCTACfwd 5' CACTCTCTGGCCTCACAAGG 3’ 59°C 319 HSD17B3 (rat) NM_054007 5' GGAAGCCGTGTGAAGGTT 3' 5' GACACTCTGGCTCTCACC 3’ 58°C 171 JAM-3 (rat) NM_001004269.1 5' CTTCTTCCTGCTGCTGCTCT 3' 5' TCTTGGCATTGCAGTGTTGC 3' 59°C 435 SOX9 (rat) NM_080403.2 5' CATCAAGACGGAGCAACTGAG 3' 5' GTGGTCGGTGTAGTCATACTGC 3' 59°C 148 TNF-α (rat) XM_034524600.1 5' GAACTCAGCGAGGACACCAA 3' 5' GCTTGGTGGTTTGCTACGAC 3' 59°C 460 Transferrin (rat) NM_001013110.1 5' TATTGGCCCAGCAAAATGTG 3' 5' CCGGAACAAACAGAAATTGC 3' 59°C 370 ZIP9 (rat) NM_001034929.1 5' GCTGCATGCCTACATTGGTG 3' 5' GTTAGTGCTGGTGTCCTCAGGG 3' 58°C 502 ZO-1 (rat) XM_0391053461 5' CTTGCCACACTGTGACCCTA 3' 5' GGGGCATGCTCACTAACCTT 3' 59°C 262 Acc. No., Accession number; bp, base pairs; GAPDH, Glyceraldehyde 3-phosphate Dehydrogenase; ASMA, alpha smooth muscle actin; HSD17B3, hydroxy-delta-17-beta dehydrogenase 3; AMH, Anti- https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=25742759 https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1937370033 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=16924013 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=57528025 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1958679275 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=54262189 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1958768030 https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1937369646 https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=51948507 https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.thermofisher.com/order/catalog/product/10336022?SKULINK https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1982559634 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1842182100 https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=61556985 33 Mullerian Hormone; AR, Androgen Receptor; JAM-3, Junctional Adhesion Molecule-3; ZO-1: Zonula occludens-1; CXCL11, C-X-C motif chemokine ligand 11; TNF-α, tumor necrosis factor alpha; CCL17, CC chemokine ligand 17; CCL22, CC chemokine ligand 22; ZIP9, Zinc transporter; ZIP9. 2.1.8 Cell culture reagents Table 9: List of cell culture reagents Cell culture reagents Manufacturer City, Country Accutase (0.25%) Gibco Frankfurt, Germany Bovine calf serum (BCS) GE Health-Thermofisher Frankfurt, Germany Bovine serum albumin (BSA) Sigma-Aldrich Taufkirchen, Germany phosphate-buffered saline (PBS) Gibco Frankfurt, Germany DMEM medium high glucose Gibco Frankfurt, Germany DMEM/F-12 medium Gibco Frankfurt, Germany Dulbecco's phosphate-buffered Gibco Frankfurt, Germany saline (DPBS) F-12 nutrient mix Gibco Frankfurt, Germany Fetal calf serum (FCS) Gibco Frankfurt, Germany HEPES Gibco Frankfurt, Germany Insulin transferrin selenium (ITS) Thermofisher Frankfurt, Germany L-glutamine Gibco Frankfurt, Germany Mercaptoethanol Gibco Frankfurt, Germany MEM non-essential Sigma-Aldrich Taufkirchen, Germany amino acid solution Penicillin/streptomycin (P/S) Gibco Frankfurt, Germany RPMI 1640 medium Gibco Frankfurt, Germany Sodium pyruvate Gibco Frankfurt, Germany TrypLE Gibco Frankfurt, Germany 34 2.1.9 siRNA transfection reagents Table 10: List of transfection reagents Name Manufacturer City, Country Lipofectamine™ RNAiMAX Invitrogen Karlsruhe, Germany Negative control siRNA Invitrogen Karlsruhe, Germany Opti-MEM™ Thermofisher Scientific Frankfurt, Germany siRNA Silencer ® Select Invitrogen Karlsruhe, Germany 2.1.10 siRNA sequences Table 11: List of siRNA sequences siRNA oligo (Species) Sequence (5′ 3′) Catalogue number ZIP9 siRNA (rat) 5′ GGAUUAAGUAAGAGCAGUAtt 3′ 4392420 5′ UACUGCUCUUACUUAAUCCta 3′ AR siRNA (rat) 5′ CCGGAAAUGUUAUGAAGCAtt 3′ 4390771 5′ UGCUUCAUAACAUUUCCGGag 3′ 2.1.11 Equipments Table 12: List of equipments Equipment Manufacturer City, Country Cell culture CO2 incubator Memmert Schwabach, Germany Desktop centrifuge Biofuge Fresco Hettich Electronic Tuttlingen, Germany balance SPB50 Heat block DB-2A Techne Cambridge, UK Elekta 6-MV Synergy photon linear accelerator Elekta Stockholm, Sweden Herasafe™ KS biological safety cabinet Thermo Electron Co. Berlin, Germany Horizontal mini electrophoresis system PEQLAB Erlangen, Germany Labsystems plate reader Labsystem Helisinki, Finland Microwave oven Samsung Schwabach, Germany https://www.thermofisher.com/order/catalog/product/4390771?tsid=Email_POE_OC_OrderConfirm%20%0D%20_SKULINK 35 Millicell ERS-2 Volt-ohm Meter Merck Millipore Darmstadt, Germany Mini centrifuge Galaxy Heathrow Scientific San Diego, USA Mini-rocker shaker MR-1 PEQLA Erlangen, Germany MiniOpticon™ Real-Time PCR BioRad Munich, Germany NANODROP ND 2000 Promega Mannheim, Germany Olympus X81 Fluorescence Microscope Olympus Hannover, Germany PCR thermo cycler Biozyme Oldendor, Germany Power supply units Consurs Reiskirchen, Germany SDS gel electrophoresis chambers Semi-dry-electroblotter BioRad Munich, Germany T10 automatic cell counter BioRad Munich, Germany Tecan infinite M100 Microplate reader Tecan Crailsheim, Germany Ultrasonic homogenizer Bandelin Sonopul Bandelin Berlin, Germany 2.1.12 Miscellaneous Table 13: List of Miscellaneous Item Manufacturer City, Country Black 96-well plates Greiner Frickenhausen, Germany Cell culture 12-24-48 well plates Greiner Frickenhausen, Germany Cell inserts 0,4 µm of 24 well plate Greiner Frickenhausen, Germany Cell strainers 100-µm Corning/Greiner Frickenhausen, Germany Enhanced chemiluminescence (ECL) reagents Amersham Freiburg, Germany Filters 0,22 µm Sigma-Aldrich Steinheim, Germany Protein size markers Invitrogen Karlsruhe, Germany PVDF membranes Merck Chemicals Schwalbach, Germany S-Monovette 2,7 mL tubes Sarstedt Nümbrecht, Germany prepared with EDTA K3 T 75 cell culture flasks TPP Frankfurt, Germany 36 Graph Pad prism 5 Graph Pad software Inc. San Diego, USA 2.2 Buffer solutions and reagent used for western blot 2.2.1 Western blots buffers Table 14: Western blot buffers Cell Lysis buffer 2 ml: 200 µL 10x Lysis buffer 1750 µL of distilled water 1 mM PMSF 25 µL of Protease Inhibitor 25 µL of Phosphatase Inhibitor, *: prepare fresh every time before cell lysis 10X Phosphate buffered saline (PBS) 4 g KCl 4 g KH2PO4 160 g NaCl 23 g Na2HPO4 * H2O Dissolved in 1L H2O, pH to 7.4 with HCl 10X Tris base buffered saline (TBS) 24.2 g Tris base 80 g NaCl Dissolved in 1L H2O, pH to 7.4 with HCl Washing buffer TBS/T 1 X TBS 0.1% (v/v) Tween-20 Blocking buffer (100 ml) 100 ml 1 X TBS 0.1 ml Tween-20 5 g Non-fat dry milk 10 X Electrophoresis buffer 30.3 g Tris base 144 g Glycine 10 g SDS Dissolved in 1L distilled water 37 Stripping buffer 6.25 ml 1 M Tris-HCl 2 ml 10% SDS 700 µl β-mercaptoethanol* Make volume up to 100 ml with water * added freshly just before stripping of membrane 2.3 Cell culture 2.3.1 93RS2 Sertoli cells The prepubertal rat Sertoli cells (SCs) line without androgen receptor (AR) expression 93RS2 (Jiang et al., 1997) are cultured in DMEM/F-12 with L-glutamine supplemented with 10% FCS, 1% penicillin/streptomycin (P/S), and 1% insulin transferase selenium (ITS ) in a humidified incubator (37 °C, 5% CO2). The media were changed every 2 days. After the medium was removed by aspiration, cells were washed with Dulbecco's phosphate-buffered saline (PBS) without Ca2+ and Mg2+ and subsequently harvested by incubation with accutase (0.25%) for 4 min at 37°C. 2.3.2 Irradiation of 3T3-J2 mouse fibroblast and preparation of conditioned medium (CM) The 3T3-J2 mouse fibroblast cell line (KER-EF3003) were purchased from Kerafast (USA) and were cultured as advised by the manufacturer in a humidified incubator (37°C, 5% CO2). Complete DMEM (+ 2 mM L-glutamine, 10% bovine calf serum (BCS) and 1% P/S was replaced every 2 days until the cells reached 60-80% confluency in a T175 flask. Cells were washed with DPBS, incubated with TrypLE for 5 min at 37°C until detachment, and filled up to 10 mL F medium [375 mL complete DMEM/F-12 and 125 mL of F12 nutrient mix]. The cell suspension (1.0-2.5 X 106 cells/mL) was irradiated with a total dose of 30 Gy (=3,000 rad) with a Synergy Elekta 6-MV photon linear accelerator and cultured in a T175 flask (7.0 X 106 cells/30 mL F medium) and incubated at 37°C and CO2. After 72 hrs, medium was collected and centrifuged at 300xg for 5 min at 4°C. The supernatant was filtered through 0.22 µm filters. For immediate use, one part of fresh F medium was mixed with three parts of CM (filtered supernatant) supplemented with 10 µM ROCK inhibitor (diluted in water) and 0.1 nM cholera toxin (diluted in water) resulting in complete CM, which can be stored for up to 1 week at 4°C or up to 6 months at -80°C. http://www.sciencedirect.com/science/article/pii/S0303720715000738#bib0100 38 2.4 Animals 11-13 week-old adult male Sprague Dawley rats ((Crl:CD (SD)IGS) weighing 150-200 g were purchased from Charles River (Germany). The study was approved by the local committee on the Ethics of Animal Experiments of the Justus Liebig University (permit number: M_695 Giessen, Germany) and all experiments were performed in accordance with relevant guidelines and regulations. 2.5 Isolation of primary adult rat Sertoli cells and PCs 2.5.1 Isolation of primary adult rat Sertoli cells and PCs using enzymatic digestion Adult male Sprague Dawley rat weighing 150-200 g was anesthetized with 5% isoflurane. Testes were removed, briefly rinsed in 70% ethanol, washed with sterile Dulbecco's phosphate buffered saline (DPBS) and placed in Dulbecco Modified Eagle Medium/Nutrient Mixture F- 12 (DMEM/F-12). After removal of the tunica albuginea, tubules of one testis were disaggregated without rupturing them, transferred to enzymatic solution 1 (10 mL DPBS and 1.5 mg/10 mL collagenase type I) and agitated for 3 min in a shaking water bath at 35°C (120 oscillations/min). The suspension was allowed to settle by gravity for 5 min at room temperature (RT) and the supernatant, containing mostly Leydig cells (LCs), carefully aspirated. Tubules were rinsed gently thrice with 10 ml DPBS and incubated for 15 min in enzymatic solution 2 [10 mL DPBS with 0.5 mg/mL collagenase, 0.5 mg/mL hyaluronidase and 0.2 mg/mL deoxyribonuclease I (DNASE I)] in a shaking water bath at 35°C (120 oscillations/min) to dislodge peritubular cells (PCs) from the tubules until they were free from surrounding tissue, but still intact. Then 15 mL DPBS was added and tubules allowed to settle. The supernatant enriched in PCs was collected and centrifuged (500xg, 10 min). The cell pellet was suspended in complete DMEM/F-12, seeded into a T75 flask (~ 5 X 106 cells/flask) and maintained in a humidified incubator (37°C, 5% CO2). After 3 days, the PCs reached confluency and were used for further experiments. The tubules were transferred to 2 ml DPBS, added slowly on top of 38 mL 5% Percoll (in DPBS) in a 50 mL centrifuge tube and allowed to settle for 20-30 min at room temperature (RT). After discarding the top 35 mL Percoll, the tubules were washed 3 times with DPBS and incubated in enzymatic solution 3 (10 mL DPBS with 1 mg/mL trypsin and 0.2 mg/mL DNase I) for 15 min in a shaking water bath at 35°C (120 oscillations/min). Tubules were shaken 39 vigorously every 3 min by hand for 5 sec until complete digestion, which was stopped by adding 3 mL 100% fetal calf serum (FCS). The SC-enriched tubule suspension was transferred to a new 50 mL centrifuge tube containing 25 mL complete DMEM/F-12 [10% FCS, 1% P/S, 1% insulin transferrin-selenium (ITS) to decrease the viscosity prior to filtration through 100-µm cell strainers. The filters were inverted over a 50 mL centrifuge tube and collected by washing with complete DMEM/F-12, and centrifuged (500xg, 5 min, RT). After washing twice with DPBS, cells were resuspended in 10-15 mL complete DMEM/F12 and cell viability examined by trypan blue staining using a TC10 cell counter. Approximately 18-36 × 106 cells were obtained from one testis of one adult rat. 2.5.2 Conditional reprogramming of primary adult rat Sertolie cells by culturing freshly isolated SC clusters with CM The conditional reprogramming (CR) was done according to (Liu et al., 2017) with modifications. Briefly, enriched SC clusters (~3.5-5.0 × 106) were suspended in 5 mL complete CM supplemented with 10 µM ROCK inhibitor, seeded into a collagen-coated T25 flask and were cultivated in a humidified incubator at 37°C and 5% CO2. Coating was done with 5 mL collagen type I (50 μg/mL) in DPBS in the presence of 1% 1 M acetic acid for 1 hr in a humidified incubator at 37°C and 5% CO2. After washing with DPBS flasks were sterilized with UV light for 1 hr before use. 48 hrs after seeding, medium was discarded and hypotonic shock was performed with 4 mL autoclaved hypotonic solution (20 mM Tris-HCl, pH 7-7.4) for exactly 2 min at RT. After washing with DPBS, 5 mL fresh complete CM was added and cell growth was monitored regularly with a Leica microscope. After 4 days, SCs were washed with DPBS, detached with 3 mL TrypEL for 3 min at RT, collected, centrifuged (600×g, 3 min) and then seeded on a fresh collagen-coated T25 flask in 5 mL fresh complete CM. SCs were sub-cultured every 4-5 days and complete CM was replaced every 2 days. After 5-12 days SCs reached confluency. 40 2.6 Isolation of rat blood-derived-monocytes (RBDM), purity assessment and polarization toward M0, M1 and M2 macrophages 2.6.1 Isolation and purity assessment of RBDM RBDM were isolated according to de Almeida et al. (2000) with some modifications. Adult male Sprague Dawley rats ((Crl:CD (SD)IGS; Charles River, Germany) weighing 150-200 g were anesthetized with 5% isoflurane and sacrificed (Abbott, Germany). Peripheral blood was collected directly from the heart into S-Monovette 2,7 mL tubes prepared with EDTA as an anti-coagulant. The collected blood was diluted 1:2 with phosphate buffered saline (PBS, Gibco) and mononuclear cells were purified with gradient centrifugation (800×g, 20 min, no brakes) with LymphoprepTM gradient (Stemcell, Norway) at room temperature (RT). Then cells were aspired from the middle white layer of the interface and washed 2 times with PBS with gradually decreasing centrifugation (600×g followed by 450×g) to remove the lymphocytes. The enriched RBDM fraction was cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (FCS, Gibco), 1% P/S (Gibco), 1 mM sodium pyruvate (Gibco), 1% HEPES (Gibco), 1 % MEM non-essential amino acid solution (Sigma-Aldrich) and 50 µM 2- mercaptoethanol (Gibco) in a humidified incubator (37°C, 5% CO2). Cell viability was examined by trypan blue (Gibco) staining using a TC10 cell-counter (BioRad). Approximately 1 × 106 cells were seeded into each well of a 24-well-plate and after 6 hrs, cells were carefully washed with PBS. The attached cells were stained with Cluster of differentiation 68 (CD68, a cytoplasmic marker specific for rat monocytes) to assess purity of the RBDMs, which was > 95% with very few contaminating lymphocytes which could be distinguished from RBDM by their weak staining of CD68 in addition to their small size. To test the response of monocytes to LPS, 5 × 105 RBDM cells were seeded into a 24-well- plate and incubated with RPMI 1640 medium containing 10% FCS, 1% P/S and 10 ng/mL LPS (Sigma-Aldrich) for 48 hrs. The controls were only incubated in medium without LPS. After 48 hrs RNA was collected and gene expression analyzed with qRT-PCR. 2.6.2 Differentiation of RBDM into M0 macrophages and polarization into M1 and M2 macrophages For differentiation and polarization of RBDM the protocol of Spiller et al. (2016) and the recommendations of the manufacturer PromocellTM were used with some minor modifications. Briefly, 1 × 106 RBDM cells/mL were cultured for 5 days in RPMI 1640 containing 10% FCS 41 and 50 ng/mL mouse macrophage colony stimulating factor (M-CSF; premium grade; Miltenyi Biotec) in 25 cm2 ultra-low attachment flasks in a humidified incubator (37°C, 5% CO2) to differentiate them into M0 macrophages. Medium was changed after 5 days. At day 6, different substances were added to achieve polarization: To get M1 macrophages, M0 macrophages were treated with 10 ng/mL LPS and 50 ng/mL recombinant interferon gamma (IFN-γ; Promocell); and for M2 macrophages, 40 ng/mL recombinant interleukin-4 (IL-4; Promocell) and 20 ng/mL recombinant interleukin-13 (IL-13; Promocell) were used. Macrophages were polarized for 48 hrs in ultra-low attachment 25 cm2 flasks. Afterwards RNAs were collected for qRT-PCR or the cells were detached using PBS containing 5 mM EDTA for 40 min at 4°C. Instead of enzymatic detachment, we used EDTA to avoid alterations in the macrophages as indicated by Chen et al. (2015). After counting with TC10, cells were used in the transmigration assay. 2.7 Immunofluorescence Primary adult Sertoli cells (PASC1) or RBDMs were plated into 24-well-plates (1 mL/well) and incubated for 6 hrs at 37°C and 5% CO2. Cells were plated at a density of 3.0 × 104 into 24- well-plates (1 mL/well) and incubated 48 hrs at 37°C and 5% CO2. After stimulation of PASC1 with 10 nM testosterone (T) for 24 hrs, cells were rinsed with DPBS and fixed with 100% ice- cold methanol on ice for 10 min. Cells were washed with PBS three times for 5 min, and then incubated in blocking solution (PBS with 3% BSA and 0.3% Triton X-100) for 1 hr at RT. Then blocking solution was replaced by fresh blocking solution containing the primary antibodies with the indicated dilutions (Table 3) and incubated overnight at 4°C. Cells were washed 3 times with DPBS for 3 min each at RT on an orbital shaker, and fresh blocking solution with the appropriate secondary antibody (Table 4) was added for 1 hr at RT. After washing 3 times with DPBS, images were obtained using an inverse Olympus IX81 microscope equipped with a fluorescence system. ImageJ was used for IF measurements according to the protocol http://www.slu.se/PageFiles/388774/Pacho%-20ImageJ%20measuringcell-fluorescence.pdf, freely available at http://rsbweb.nih.gov/ij/. (Accessed between Apr 2019 and Sep 2021). Six cells with surrounding TJs from 3 independent experiments within or closest to the diagonals of the square optical field were quantified and analyzed with GraphPad Prism5. http://www.slu.se/PageFiles/388774/Pacho%25-20ImageJ%20measuringcell-fluorescence.pdf http://rsbweb.nih.gov/ij/ 42 2.8 RNA extraction, RT-PCR and quantitative real time PCR 2.8.1 RNA Isolation For all qRT-PCR studies, immortalized 93RS2 cells and one adult rat testis were used as controls. RNAs were collected directly or from confluent PASC1 cells treated with T. Total RNA was isolated from 93RS2 and testosterone treated PASC1 by the RNeasy Mini kit. Briefly, cells were lysed with 700 µl RLT buffer after washing 2 times with ice-cold PBS. Lysed cells were transferred into a microcentrifuge tube, and homogenized by passing through a 24-gauge needle attached to a 1 ml plastic syringe for 4-5 times. These lysates were transferred into a new Eppendorf tube and mixed thoroughly with an equal volume of 70% ethanol. Samples up to 700 µl of mixture were transferred to another RNeasy spin column placed in a 2-ml collection tube and centrifuged for 15 s at 16,000 ×g. The runoff was discarded and the RNeasy spin column are washed with 700 µl of RW1 by centrifuging for 15s at 16,000×g. Then the RNeasy spin column was carefully removed, transferred to new collection tube and washed with 500 µl RPE buffer. This step was repeated one more time by centrifugation for 2 min at 10,000×g. Any possible contamination of RPE buffer in the RNeasy spin column was removed by an additional centrifugation at full speed. To elute total RNA, 30-50 μl of RNase-free water were added directly to another RNeasy spin column membrane and centrifuged at 10,000×g for 1 min. The concentration and quality of RNA was measured spectrometrically by Nano drop (Promega, Mannheim). 2.8.2 DNase digestion RNA preparations should be free of DNA contamination prior to reverse transcription-PCR (RT-PCR). DNA contamination was removed by treating each RNA sample with DNase I (Invitrogen, Karlsruhe) at room temperature for 15 min in the reaction mixture given below. 2.8.3 DNase digestion reaction mix: Table 15: DNase digestion reaction mixture Volume Component X μl 2 μg RNA 43 After DNA digestion, DNase I was inactivated by adding 2 μl of 25 mM EDTA (pH 8.0) to each sample and subsequently heat inactivated at 65°C for 10 min. 2.8.4 cDNA synthesis DNA digested samples were reverse transcribed by using kit H-Minus (PeqLab/VWR, Erlangen, Germany). Briefly, oligo-dTs and dNTPs were mixed with RNA samples as given in Table 15. The reaction mixture was heated at 65°C for 5 min and quickly chilled on ice. 2.8.5 Denaturation of RNA and primer annealing: Table 16: RNA mix Volume Component 21μl 2.5 μg of DNase I digested RNA 2 μl Oligo dT 2 μl dNTPs (A,C, G and T, each 10 mM) To the RNA mix sample, RT mix was added as shown in Table 16, pre-heated for 2 min at 42°C and 1 μl of the reverse transcriptase enzyme was added to each sample. The reaction mixtures were incubated for 50 min at 42°C. Subsequently reactions were inactivated by heating at 75°C for 15 min. Samples were stored at -20°C for further analysis. 1 μl DNase I (10 U/μl) 2 μl 10 X DNase I buffer to 20 μl RNase free water 44 2.8.6 RT mix: Table 17: RT mix Volume Component 8 μl 5 X M-MLV RT buffer 2 μl RNase-free water 4 μl 0.1 M DTT 2.8.7 RT-PCR A total of 1 × 105 cells of each cell line were grown as described above. Total RNA was extracted with the RNAeasy kit (Qiagen, Hilden, Germany) in accordance to the user manual. Reverse transcription was performed using a cDNA synthesis kit H-Minus (PeqLab/VWR, Erlangen, Germany) according to the supplier’s instructions. Primers were designed on the NCBI Primer-Blast algorithm and purchased from Invitrogen/Thermo Scientific (Table 8). The other PCR reagents were purchased from Bio&Sell (Nuremberg, Germany). Semi-quantitative PCR was performed with 1 µg cDNA. GAPDH was used as a positive control. After an initial heating to 95°C for 4 min, each cycle consisted of denaturing at 95°C for 30 sec, annealing at 58°C for 20 sec and elongation at 72°C for 40 sec except for the final extension which lasted 5 min. The program consisted of 35 cycles. 2.8.8 Quantitative real-time PCR (qRT-PCR) The mixture of qRT-PCR differs from a normal PCR with addition of the double strands DNA (dsDNA) specific fluorescent reporter probes such as SYBR green. The reporter probes can bind to the dsDNA every time the DNA is polymerized, and emit fluorescence detected by a detector. The increasing fluorescence signal is directly related to the exponential increase of DNA product in each cycle and recorded in the real-time PCR thermocycler, which is used to determine the threshold cycle (Ct) value and facilitates quantifying gene expression. Real -time PCR amplification was done in duplicates with iQTM SYBR Green Super-mix on the iCycler iQ System. After an initial heating at 94°C for 5 min, 40 cycles were performed: denaturation at 94°C for 14 sec, annealing at 59°C for 30 sec, and extension at 72°C for 15 sec. A final extension at 72°C was done for 10 min. Gene expression was measured after reaching the ct 45 value and calculated using the Delta – Delta Ct method. GAPDH was used for normalization (Table 8). The primers were designed by primer Table 8. Gradient PCR was employed to determine the optimal annealing temperature for individual genes. According to it the temperature of each gene is set. All primers’ efficiencies were between 100 ± 15 %. The preparation of a typical 25 µl qRT-PCR reaction mix is given below. Table 18: qRT-PCR MIX Realtime PCR amplification with iQTM SYBR® Green Supermix was performed in duplicate by using the MiniOpticon cycler System (Bio-Rad) according to manufacturer’s procedure. 2.9 Transmigration assay of macrophages The CytoselectTM transmigration assay kit (Cell Biolabs) was used following the manufacturer's protocol. Briefly, PASC1 cells, PC or a co-culture of both were seeded on pre-coated inserts with matrigel (Corning) or without coating in 500 µl complete DMEM/F12. Controls were performed with medium only. For coating, 9 µg/cm2 MG in cold medium was added on top of the inserts and incubated in a humidified incubator (37°C, 5% CO2) for 1 hr until solidification of MG. Washing with PBS was done before use. After 48-72 hrs, the cells or the co-cultures formed monolayers and PASC1-only (without MG coating) inserts were treated with 10 nM T, 10 ng /mL TNF-α or 200 pg/mL IL-6 for 48 hrs. Then, treatments and controls were used for the transmigration assay. Component Volume per reaction cDNA 1 µl 2X iQ SYBR green super mix 12.5 µl Forward and reverse primer mix (10 pM/µl) 1 µl DNase/RNase free water 10.5 µl Total volume 25 µl 46 For this, M0, M1 or M2 macrophages were detached as previously mentioned and collected separately at a concentration of 1.0 × 106 cells/mL in RPMI 1640 containing 0.5% FCS (serum- low medium). 2 µl of 500X LeukoTrackerTM (Cell Biolabs) to 1 mL of macrophages was added and macrophages were incubated for 1 hr at 37°C and 5% CO2. Next, macrophages were centrifuged at 400×g for 2 min, the medium aspired and cells were washed twice with serum- low medium and reconstituted at 1.0 × 106 cells/mL with serum-low medium. The medium was removed from the inserts without disturbing the monolayer and transferred to a new 24-well plate containing 500 µl of RPMI 1640 (plus additives) in addition to 100 ng/mL Macrophage chemoattractant protein-1 (MCP1). For the transmigration assay, 100 µl of 1 × 105 labeled M0, M1 or M2 macrophages were added to each insert and incubated for 6 hrs at 37°C and 5% CO2. 400 µl of the bottom medium containing the transmigrated macrophages were transferred to a new well containing 150 µl of 4X lysis buffer (Cell Biolabs), incubated for 5 min at RT with shaking (100 oscillations/min) and then 150 µl of the mixture were transferred to black 96-well plates (Greiner). Fluorescence intensity was measured at 480/520 nm (extinction/emission) in an ELISA reader (Tecan). Quantification was done by serial dilutions of LeukoTracker TM- labeled macrophages, which after lysing were measured in the ELISA reader as described. The blank of serum-low medium with lysis buffer was subtracted from the results. 2.10 Measurement of transepithelial resistance (TER) TER measurement was performed as reported by Stammler et al. (2013). Briefly, 6.0 × 104 PASC1 cells/cm2 were seeded on 0.4-μm inserts for 24-well plates (Greiner) and cultured for 48 hrs until they reached confluency. Then, T (10 nM), IL-6 (200 pg/ml), BMP2 (25 ng/ml), or TGF-β3 (3 ng/ml) were added to the inserts. Controls received only vehicle. For TER measurement of PCs, 3.0 × 105 PCs (cells/cm2) were seeded on inserts for 2 days. For co-culture, 6.0 × 104 PASC1 (cells/cm2) were seeded on inserts for 2 days, then 2.0 × 105 PCs (cells/cm2) were seeded on top of them and cultured for 2 days. TER measurements were done with a Millicell ERS-2 epithelial Volt-Ohm meter (Merck Millipore). Ω/cm2 was calculated according to the protocol of the manufacturer and by setting the resistance of cell-free inserts to zero. 2.11 Tracer diffusion assay (TDA) The tracer diffusion assay was performed as published by Stammler et al. (2013). In brief, cells cultured for 48 hrs on inserts as described above were incubated with fresh medium containing 47 5 mg/mL FITC-coupled Dextran, molecular weight 4 kDa (FD4, Sigma-Aldrich) and loaded into the upper compartment of the inserts. After 4 hrs a 100 µl sample was taken from the lower compartment and fluorescence intensity was measured at 490 nm/520 nm (extinction/emission) in an ELISA reader (Tecan) in black 96-well plates (Greiner). 2.12 Silencing expression of ZIP9 or AR via siRNA For silencing ZIP9 or AR expression, PASC1 cells were treated with commercially available siRNA directed against ZIP9 or AR by following the manufacturer’s protocol (Invitrogen). The oligonucleotides mentioned in Table 11 were used. Negative control siRNA (nc-siRNA) was provided in the siRNA kit from the same manufacturer. After incubation of PASC1 for 48 hrs with ZIP9-siRNA, AR-siRNA, or nc-siRNA, preparation of samples for qRT-PCR, TER measurement, or immunofluorescence experiments were carried out as described above. 2.13 Plasma membrane labeling with testosterone-BSA-FITC PASC1 cells were cultured as described above in 24-well plates at a density of 3 × 103 cells/well until reaching a confluency of approximately 80%. The cells were then treated with either 10 nM testosterone or 1 µM of IAPG for 1 hr. Controls received only the testosterone vehicle ethanol. Thereafter, testosterone 3-(O-carboxymethyl)-oxime:bovine serum albumin- fluorescein isothiocyanate conjugate (T-BSA-FITC; Sigma-Aldrich, Steinheim, Germany) dissolved in Tris buffer (pH 7.2) was added to each well at a final concentration of 10 µM, and incubation was continued at room temperature for another 20 min. The medium was then removed by aspiration. In order to label nuclei, cells were fixed at room temperature with 3.7% formaldehyde that contained 20 ng of 4,6-diamino-2-phenylindole (DAPI). After 15 min, the formaldehyde/DAPI solution was removed by aspiration. Cells were washed with DPBS (Gibco) and then overlayed with 400 µL PBS before imaging. Images were taken by an inverse Olympus IX81 microscope (Olympus). Non-specific binding was assessed by incubating the cells with 10 µM BSA-FITC without testosterone dissolved in Tris buffer (pH 7.2) for 20 min at room temperature. 48 2.14. Treatments and sample preparations for western blots (WB) 2.14.1 Preparation of cell lysates from PASC1 A total of 3 × 104 PASC1 cells/dish were grown in 5 cm culture dishes as described above. Cells were then incubated for 24 hrs with 1% FCS before testosterone or IAPG were added to the medium to reach the desired final concentration. Ethanol vehicle for testosterone was added to the IAPG-treated cells and untreated controls at the same concentration as in cell cultures treated with testosterone. After 24 hrs, the medium was aspirated and the cells were washed twice with ice-cold DPBS. Cells were then incubated with 400 µL lysis buffer (Cell Signaling) containing 1 µM PMSF, 1× protease inhibitor cocktail (Roche), and 2 µg/mL pepstatin which was added immediately before use. All further steps were carried out on ice. After 5 min of incubation, cells were detached using a cell scraper. The suspensions were then transferred into 1.5 mL vials and sonicated 5 times for 1 sec each with intervals of 1 sec. After centrifugation of the lysates at 4°C and 13,000×g for 10 min, the protein concentration in the supernatants was determined at 540 nm using the bicinchoninic acid protein assay reagent kit (Pierce) and a plate reader (Tecan). The BSA protein standard contained lysis buffer at the same concentration as in the samples from the cell lysates. Supernatants were then aliquoted and maintained at −20 °C until further use. 2.14.2 SDS-polyacrylamide gel electrophoresis The SDS polyacrylamide gel electrophoresis (SDS-PAGE) technique separate the proteins according to their size. The gels were prepared freshly, depending on the size of investigated proteins; Separating gel and Stacking gel were made according to the recipe given below. Table 19: Separating gel, SDS –PAGE gel preparation Solutions 7.5%* 10%* 12.5%* 15%* Water 4.85 ml 4.01 ml 3.17 ml 2.35 ml 1.5 M Tris- HCl pH 8.8 2.5 ml 2.5 ml 2.5 ml 2.5 ml 10% (w/v) SDS 100 µl 100 µl 100 µl 100µl Acrylamide 2.5 ml 3.34 ml 4.17 ml 5 ml 49 10% (w/v) APS** 50 µl 50 µl 50 µl 50 µl TEMED 5 µl 5 µl 5 µl 5 µl Total 10 ml 10 ml 10 ml 10 ml Table 20: Stacking gel *The gel percentage depends on the molecular weight of the protein of interest (based on 5:1 acrylamide/bisacrylamide ratio). ** Ammoniumpersulfate (APS) –prepared freshly every time. 2.14.3 Western blotting A total of 10 µg protein from PASC1 cell lysates was run on SDS-PAGE gels containing 10% acrylamide and 0.3% N,N′-methylene-bis-acrylamide (Table 19). Biotinylated proteins (Cell Signaling) were run in parallel as molecular weight markers. After electrophoresis, proteins were semi-dry electro-blotted onto PVDF membranes (Merck Chemicals) for 30 min at 0.5 V/cm2. The membranes were then incubated for 1 hr at room temperature in 5% (w/w) non-fat dry milk. Primary antibodies against phospho-Erk1/2, total-Erk1/2, or beta-actin (Table 3) were diluted according to the recommendations of the manufacturers and then poured on the PVDF membranes which were incubated overnight at 4°C for all antibodies with dilutions and Solutions 4%* Water 3 ml 0.5 mM Tris-HCl pH 6.8 1.25 ml 10% (w/v) SDS 50 µl Acrylamide 0.65 ml 10% (w/v) APS** 25 µl TEMED 5 µl Total