Evaluating the in vitro effects of selective and potent 

non-selective fibroblast growth factor receptor inhibition 

in human BL2 cells as potential therapeutic targets for 

multiple sclerosis

Inauguraldissertation

zur Erlangung des Grades eines Doktors der Medizin

des Fachbereichs Medizin

der Justus-Liebig-Universität Gießen

vorgelegt von

von Au, Laureen Juliana

aus Filderstadt

Gießen (2025)



Aus dem Fachbereich Medizin der Justus-Liebig-Universität

Gießen

Universitätsklinikum Gießen und Marburg, Standort Gießen

Medizinisches Zentrum für Neurologie und Neurochirurgie

Neurologische Klinik

Experimentelle Neurologie

Gutachter: Prof. Dr. med. Martin Berghoff

Gutachter: Prof. Dr. Lienhard Schmitz

Tag der Disputation: 18.11.2025



Contents

1 Introduction 1

1.1 Multiple Sclerosis (MS) . . . . . . . . . . . . . . . . . . 1

1.1.1 Etiology of MS . . . . . . . . . . . . . . . . . . . 3

1.1.2 MS pathophysiology . . . . . . . . . . . . . . . . 4

1.1.3 MS symptoms . . . . . . . . . . . . . . . . . . . 8

1.1.4 Phenotypes of MS . . . . . . . . . . . . . . . . . 9

1.1.5 MS diagnosis . . . . . . . . . . . . . . . . . . . . 11

1.1.6 MS treatment . . . . . . . . . . . . . . . . . . . . 13

1.2 B lymphocytes . . . . . . . . . . . . . . . . . . . . . . . 20

1.2.1 B cell development . . . . . . . . . . . . . . . . . 21

1.2.2 B cell activation . . . . . . . . . . . . . . . . . . . 22

1.2.3 B cell function . . . . . . . . . . . . . . . . . . . . 25

1.2.4 B cells in MS . . . . . . . . . . . . . . . . . . . . 30

1.3 Cytokines . . . . . . . . . . . . . . . . . . . . . . . . . . 32

1.3.1 The role of cytokines in MS . . . . . . . . . . . . 33

1.4 FGFs and FGFRs . . . . . . . . . . . . . . . . . . . . . 38

1.4.1 FGF/FGFR signaling pathway . . . . . . . . . . . 41

1.4.2 FGF/FGFR signaling in MS . . . . . . . . . . . . 43

1.4.3 Role of FGFs and FGFRs in B cells . . . . . . . 45

1.4.4 Therapeutic approaches of FGFR inhibition . . . 48

I



1.5 Selective and potent non-selective FGFR tyrosine ki-

nase inhibitors . . . . . . . . . . . . . . . . . . . . . . . 50

1.5.1 Selective FGFR inhibitor - infigratinib . . . . . . . 50

1.5.2 FGFR inhibitor - AZD4547 . . . . . . . . . . . . . 51

1.5.3 Multikinase inhibitor - dovitinib . . . . . . . . . . 53

2 Aims 55

3 Materials and Methods 57

3.1 Cell line . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

3.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . 58

3.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . 76

3.3.1 BL2 cell culture . . . . . . . . . . . . . . . . . . . 76

3.3.2 Experimental treatment of BL2 cells . . . . . . . 79

3.3.3 Cell proliferation assay . . . . . . . . . . . . . . . 81

3.3.4 Cytotoxicity assay . . . . . . . . . . . . . . . . . 83

3.3.5 Protein biochemistry . . . . . . . . . . . . . . . . 84

3.3.6 Molecular biology . . . . . . . . . . . . . . . . . . 86

3.3.7 Immunoflourecence . . . . . . . . . . . . . . . . 88

3.3.8 Statistical analysis . . . . . . . . . . . . . . . . . 91

4 Results 92

4.1 All substances do not affect the proliferation of BL2 cells 92

4.2 The FGFR inhibition has no cytotoxic impact on BL2 cells 93

II



4.3 The multikinase inhibitor dovitinib decreases cellular

FGFR1 expression . . . . . . . . . . . . . . . . . . . . . 94

4.4 Reduced FGFR1 cellular expression after FGFR inhibi-

tion compared to FGF2-treated cells . . . . . . . . . . . 97

4.5 Selective and multikinase FGFR inhibition decreases

FGFR2 mRNA levels . . . . . . . . . . . . . . . . . . . . 97

4.6 FGFR inhibition modulates FGFR downstream

molecule pERK . . . . . . . . . . . . . . . . . . . . . . . 100

4.7 Selective FGFR and multikinase inhibitors increase

cellular pAkt expression in BL2 cells . . . . . . . . . . . 102

4.8 Decrease of proinflammatory cytokines IL6, IL12 by

dovitinib . . . . . . . . . . . . . . . . . . . . . . . . . . . 104

5 Discussion 107

5.1 Effects of selective FGFR and multikinase inhibitors on

BL2 cell proliferation and cytotoxicity . . . . . . . . . . . 110

5.2 FGFR1 and FGFR2 protein and gene expression in BL2

cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114

5.3 Effects of selective FGFR and multikinase inhibitors on

FGFR signaling downstream molecule pERK . . . . . . 121

5.4 Effects of selective FGFR and multikinase inhibitors on

FGFR signaling downstream molecule pAkt . . . . . . . 125

5.5 Modulatory effects of selective FGFR and multikinase

inhibitors on cytokines . . . . . . . . . . . . . . . . . . . 128

III



6 Conclusion 137

Abstract 141

Zusammenfassung 143

List of Abbreviations 145

List of Figures 152

List of Tables 153

Bibliography 154

Publications

Ehrenwörtliche Erklärung

Acknowledgement

IV



1 Introduction

1.1 Multiple Sclerosis (MS)

"a woman lost the sight of both eyes and on the next day she lost her

speech . . . on the third day a candlewick was put around her head and

she then recovered the sight of one eye and was able to open both . . .

on [Sunday] she recovered her speech and on the feast of St Michael

. . . the sight of the eye that has previously been blind” (Compston,

2005).

An early case description like this one in the Icelandic saga of

St.Thorlakr, as documented by Margaret Cormack and supported by

Poser in 1995, was of Saint Lidwina van Schiedman (born 1380, died

1433) (Compston, 2005). This historical narrative outlines a pattern

of symptoms and partial recoveries strikingly consistent with modern

descriptions of multiple sclerosis (MS).

In 1849, Friedrich Theodor von Frerichs first described its char-

acteristic symptoms, while Robert Carswell and Jean Cruveilhier

identified pathological features as “remarkable lesions of the spinal

cord with atrophy” (Carswell, 1838). In 1868, Charcot consolidated

clinical and pathological knowledge, establishing MS as a distinct

disease through his lectures on “Histologie de la Sclérose en plaques”

(Murray, 2018). This significant work shifted MS research from

1



an exploratory approach of single case reports to high-level clinical

research, resulting in several decades of intensive research into the

causes of the disease, MS pathogenesis, and possible therapeutic

approaches.

MS is an inflammatory disorder of the brain and spinal cord character-

ized by episodes of neurological dysfunction leading to chronic neu-

rodegeneration and often times to progressive disability (Compston

and Coles, 2008; Dobson and Giovannoni, 2019). Today, MS is the

most common chronic inflammatory and demyelinating disease of the

central nervous system (CNS). In 2023, around 2.8 million people

worldwide were affected, and the global prevalence increases (MSIF,

2020). The regional distribution varies across the world. Europe,

North America, Australia, and New Zealand are the populations

with the highest prevalence. Factors that might contribute to the

global and regional distribution are population genetics, environment,

and socioeconomic structures (Koch-Henriksen and Sørensen, 2010).

What is striking from an epidemiological standpoint, MS mainly affects

females (69%), and the age at onset is around 32 years. The gender

ratio varies among regions from 2-4:1 (F:M). Possible reasons could

be different female hormonal, genetic, lifestyle, and environmental

exposures compared to males. However, not only adults are affected;

around 30,000 children living with pediatric MS (under the age of 18)

have been reported worldwide (MSIF, 2020).

2



1.1.1 Etiology of MS

Scientists consider that the multifactorial influence of genetic predis-

position and environmental aspects contribute to the development of

the disease. Various genetic, microbial, and environmental risk factors

are identified as potential contributing factors, but no definite cause

has been detected (Waubant et al., 2019).

Genome screening showed that many genes increase the risk of

MS. Human leukocyte antigen (HLA) II or major histocompatibility

complex (MHC) II genes were identified to be strongly linked to the

disease. Further, family studies supported the genetic association

and showed that identical twins have a higher risk (25%) than close

relatives (3-5%). Nevertheless, the low incidence of both homozygous

twins developing MS indicates that other factors, beyond genetics,

contribute to the development of this disease (Koch-Henriksen and

Sørensen, 2010; Parnell and Booth, 2017).

Furthermore, Epstein-Barr virus (EBV) infection has been identified

as a significant risk factor (Ascherio and Munger, 2010; Høglund,

2014). Emerging evidence indicates a causal relationship in which

EBV infection occurs before the onset of MS, significantly increasing

the probability of developing the disease (Bjornevik et al., 2022). The

virus is associated with immune dysregulation and the development of

autoreactivity (Dobson and Giovannoni, 2019; Lanz et al., 2022). In

particular, Lanz et al. (2022) highlighted how EBV can contribute to MS

3



through molecular mimicry between EBV antigens and CNS proteins.

This molecular similarity could trigger the activation of autoreactive

immune cells. B cells are especially central to this process, as EBV-

infected B cells evade apoptosis and persist as carriers of chronic

infection. These infected B cells accumulate in target organs, where

they act as antigen-presenting cells (APCs) and provide survival

signals to autoreactive T cells, leading to continued immune activa-

tion, inflammation, and tissue damage, ultimately contributing to the

initiation and progression of MS (Lucas et al., 2011; Pender, 2003).

In addition, socioeconomic status, employment, smoking, sex hor-

mones, late delivery, birth control, and obesity were associated

as possible risk factors (Koch-Henriksen and Sørensen, 2010). In

addition, Vitamin D deficiency in the northern hemisphere is discussed

as a contributing environmental factor (Ascherio and Munger, 2010;

Høglund, 2014; Thouvenot et al., 2025).

There is no simple contributive association between gene and envi-

ronmental interactions, and although some risks have been identified,

research gaps exist.

1.1.2 MS pathophysiology

MS is an autoimmune disorder characterized by inflammation, de-

myelination, and axonal degeneration within the CNS. The exact

pathophysiology remains unclear, but the idea that peripheral immune

4



dysregulation and intrinsic CNS mechanisms contribute to MS devel-

opment and progression is widely accepted (Filippi et al., 2018).

The experimental autoimmune encephalomyelitis (EAE) disease

model has been instrumental in identifying numerous pathophys-

iological mechanisms relevant to MS. Findings from EAE helped

shape our understanding of how activated autoreactive T and B

lymphocytes contribute to neuroinflammation. The development

of these aggressive effector cells is proposed to be influenced by

molecular mimicry, the presentation of new autoantigens, genetic and

environmental factors. Once activated in the periphery, these cells

migrate through the blood-brain barrier (BBB), trigger inflammation

and cause tissue damage within the CNS. Upon entering the

CNS, they provoke an inflammatory cascade by releasing cytokines,

recruiting other inflammatory cells such as monocytes, T cells and

B cells, while activating microglia and astrocytes. This cascade

contributes to demyelination through the loss of oligodendrocytes

(OLs), driven by direct cellular mechanisms and the release of

inflammatory and neurotoxic mediators. Axonal injury can occur early

in the disease process as a direct consequence of inflammation or,

due to the failure of neuroprotective and regenerative mechanisms.

Over time, persistent inflammation leads to inadequate remyelination,

gliosis, neuroaxonal degeneration, and disrupted neuronal signaling,

all of which correlate with clinical symptoms and disability progression

in MS patients (Dargahi et al., 2017; Filippi et al., 2018; Yamout and

5



Alroughani, 2018).

In addition to peripheral immune mechanisms, intrinsic CNS pro-

cesses play a role in MS pathogenesis. Compartmentalized inflamma-

tion, characterized by the continuous activation of immune cells within

the CNS, has been considered as a key contributing factor, particularly

in the progressive stages of MS. This compartmentalized inflam-

mation involves the formation of ectopic lymphoid-like structures,

especially in the meninges. These structures contain B cells, T cells,

and follicular dendritic cells and maintain chronic immune activation,

contributing to cortical demyelination, axonal loss, neurodegeneration

(Dendrou et al., 2015).

Furthermore, antigens originating from the CNS can be transported to

peripheral lymphoid tissues, where they may stimulate the activation

of autoreactive immune cells. Once activated, these immune cells

have the potential to migrate into the CNS through a damaged BBB,

thereby reinforcing a cycle of persistent inflammation and progressive

neurodegeneration as described above. The disruption of the BBB

in MS is mediated by pro-inflammatory cytokines such as TNFα,

IL6, and IL17, which increase vascular permeability and promote

the expression of adhesion molecules on endothelial cells, facilitating

immune cell infiltration. This bidirectional interaction between periph-

eral immune activation and CNS infiltration plays an important role in

maintaining chronic inflammation (Dendrou et al., 2015; Filippi et al.,

2018; Lassmann, 2018).

6



Demyelinated lesions, a hallmark of MS, are found in the white and

gray matter of the brain and spinal cord. These lesions can be

classified as acute, chronic active, or inactive. Chronic lesions show

significant loss of myelin, fibrous gliosis, and minimal immune cell

infiltration. In comparison, active lesions show acute inflammation,

active demyelination, and axonal injury, with less extensive myelin

destruction. Although inflammation appears at all stages of lesion

development, early acute lesions are dominated by macrophages with

myelin debris and T, B, and plasma cell infiltrates. During this acute

phase, peripheral immune cells invade the CNS through a damaged

BBB, initiating inflammatory responses. Additionally, early MS lesions

often contain oligodendrocyte progenitor cells (OPCs), which attempt

to initiate remyelination through the formation of new myelin sheaths

(Dendrou et al., 2015; Popescu et al., 2013). However, as the disease

progresses, remyelination efforts frequently fail, and the exhaustion of

regenerative capacity is accompanied by ongoing neuronal and axonal

loss, myelin degradation, and brain atrophy. These pathological

changes strongly correlate with clinical symptoms and disabilities

observed in MS patients (Dendrou et al., 2015). Therefore, therapeutic

approaches focus on reducing neuroinflammation, protecting neurons,

and enhancing repair processes to slow down disease progression

and maintain neurological function.

7



1.1.3 MS symptoms

The symptoms, as presented in Figure 1, that may occur in MS are

heterogeneous, and the clinical course of the disease is individually

different and unpredictable. Optic neuritis, paraesthesia, and non-

specific symptoms like fatigue are usually the first manifestation of

MS (Hacke, 2010; Tafti et al., 2024). MS can cause optic neuritis,

color blindness up to temporary blindness, and internuclear ophthal-

moplegia (INO) (L. Chen and Gordon, 2005). In addition, patients

experience cranial nerve palsy, neuropathic pain, sensory and motor

impairments, central and central-vestibular symptoms, autonomic

dysfunction, fatigue, and cognitive and psychological changes (Hacke,

2010; Mattle et al., 2013).

The diverse clinical symptoms in MS result from the distribution of

lesions throughout the CNS, affecting regions like the brainstem,

spinal cord, cerebellum, juxtacortical areas, and periventricular white

matter. Central to these diverse symptoms are shared pathological

mechanisms, such as neuroinflammation, demyelination, and ongoing

neurodegeneration as described in Section 1.1.2 (Filippi et al., 2018;

Mahajan et al., 2025).

8



Figure 1: Simplified overview of symptoms associated with multiple sclerosis
(MS). Illustrating the diverse most common neurological, physical, and
psychological impairments experienced by patients with multiple sclerosis
(Tafti et al., 2024). Image created with BioRender (biorender.com).

1.1.4 Phenotypes of MS

As discussed in Section 1.1.2, MS is driven by inflammatory and

neurodegenerative mechanisms, leading to a heterogeneous clinical

presentation. Inflammatory processes drive immune cell infiltration,

lesion formation, neurodegeneration, and relapse activity. Some

individuals experience successful remyelination, while others expe-

rience persistent myelin and axonal loss, resulting in progressive

disability. The interplay between these pathological processes shape

the disease phenotype (Dendrou et al., 2015; Filippi et al., 2018).

To better define these patterns, MS has been classified into differ-

9



ent subtypes, relapsing-remitting multiple sclerosis (RRMS), primary

progressive multiple sclerosis (PPMS), and secondary progressive

multiple sclerosis (SPMS) (Fig. 2). It is important to note, however,

that clinically isolated syndrome (CIS), defined as a single episode

of neurological symptoms caused by inflammation or demyelination in

the CNS, is not classified as MS according to established guidelines.

Nonetheless, CIS can represent an early manifestation and has the

potential to progress to MS (Lublin et al., 2014).

The most common clinical course is RRMS, accounting for approx-

imately 90% of all MS cases. It is characterized by exacerbations

followed by periods of complete or partial remission of symptoms, as

seen in the life of Saint Lidwina van Schiedman (cf. Section 1.1).

A slow and steady increase in disability can appear as the disease

progresses (Plantone et al., 2016; Tafti et al., 2024). A significant

number of individuals with RRMS eventually transition to SPMS,

characterized by a pattern of continuous progression of symptoms,

with or without relapses (Plantone et al., 2016). About 10% of all

MS patients have PPMS, which manifests a continuous worsening of

symptoms from the onset of the disease, occasionally with periods of

temporary stability or mild clinical improvement (Lublin and Reingold,

1996; Lublin et al., 2014).

10



Figure 2: Systematic visualization of the clinical phenotypes of multiple
sclerosis (MS). The figure illustrates the key characteristics and progression
patterns of relapsing-remitting MS (RRMS), secondary-progressive MS
(SPMS), and primary-progressive MS (PPMS) (Lublin et al., 2014). The x-
axis represents time, while the y-axis represents the level of disability. Image
created with BioRender (biorender.com).

1.1.5 MS diagnosis

MS diagnosis depends on clinical findings, imaging, and laboratory

results. Table 1 outlines the 2017 McDonald criteria, adapted from

Thompson et al. (2018), used to diagnose MS to provide a concise

and practical reference. The dissemination in time (DIT) refers to a

new appearance of CNS lesions across distinct time intervals, while

11



the criteria of dissemination in space (DIS) indicates the presence

of different lesions in the CNS across various regions (Dobson and

Giovannoni, 2019; McGinley et al., 2021).

Table 1: Key Elements of the McDonald criteria for MS diagnosis adapted
from Thompson et al. (2018).

Clinical
Manifestations

Number of Lesions
with Clinical Evidence

Additional Data for a
Diagnosis of MS

≥2 clinical attacks ≥2 clinical objective le-
sions

None

≥2 clinical attacks 1 clinical objective lesion Dissemination in space (MRI or
more clinical attacks implicating
different sites)

1 clinical attack ≥2 clinical objective le-
sions

Dissemination in time (MRI or
demonstration of CSF-specific
oligoclonal bands or clinical at-
tacks)

1 clinical attack 1 clinical objective lesion Dissemination in space and time

Magnetic resonance imagings (MRIs) of MS patients typically reveal

multiple sclerotic plaques, associated with demyelination and reactive

gliosis. These lesions are primarily found in the periventricular white

matter, juxtacortical and infratentorial regions of the brain, and spinal

cord. In addition to MRI, the detection of oligoclonal bands (OCB) in

the cerebrospinal fluid (CSF) is an important diagnostic tool for diag-

nosing MS. OCB reflect the increased production of immunoglobulin

G due to intrathecal inflammation. Other diagnostic findings include

lymphocytic pleocytosis in the CSF, as well as abnormalities in visually

evoked potentials (Hacke, 2010; Thompson et al., 2018). In the case

of recurrent typical clinical attacks with corresponding neurological

12



findings and MRI evidence of dissemination in space, no additional

tests are necessary for a diagnosis (Fig. 3).

Figure 3: Simplified illustration of the McDonald criteria for diagnosing
multiple sclerosis (MS).The figure outlines the key components of the
diagnostic criteria, including the evidence of dissemination in space and time,
based on clinical, radiological (MRI), and cerebrospinal fluid (CSF) findings.
This simplified diagram provides an overview of how the McDonald criteria
are clinically applied in the diagnosis of MS (Thompson et al., 2018). Image
created with BioRender (biorender.com).

1.1.6 MS treatment

Since there is no definitive cure for MS, the main goal of treatment is to

manage symptoms, prevent further attacks, and slow the progression

of the disease. The treatment of patients can be divided into the man-

13



agement of acute exacerbations and long-term disease modification

strategies. Acute exacerbations are ideally treated with high-dose

glucocorticoids (Grauer et al., 2001). Alternative treatments for ex-

acerbations are plasma exchange and immunoadsorption (Hemmer,

2023). Long-term management includes disease-modifying drugs

(DMDs), lifestyle modification (e.g., exercise, mediterranean diet,

stress prevention), vitamin D supplementation, and the management

of comorbidities and symptoms (Thompson et al., 2018).

DMDs primarily prevent relapses, reduce the accumulation of MRI

lesions, and slow the progression of disability by modulating the

immune response (Gholamzad et al., 2018). DMDs are interferon beta

(IFN-β), glatiramer acetate (GA), dimethyl fumarate (DMF), terifluno-

mide, cladribine, sphingosine 1-phosphate receptor modulators (e.g.,

fingolimod, siponimod, ozanimod, ponesimod), monoclonal antibodies

(e.g., alemtuzumab, natalizumab, ocrelizumab, ofatumumab, ublitux-

imab ), and mitoxantrone.

IFN-β decreases exacerbations and the progression of RRMS by sup-

pressing T cell activity and reducing CNS pro-inflammatory cytokines

and lymphocyte invasion. Although its role has diminished, due to

the availability of more effective therapies (Goldschmidt and Hua,

2020). GA remains an efficient therapy for reducing inflammation

by shifting Th1 to anti-inflammatory Th2 lymphocytes. Although

there is long-term clinical experience, these substances have been

14



largely replaced by newer therapies that are more tolerated and

effective. DMF targets the transcription factor nuclear factor erythroid

2-related factor 2 (NRF2), important for balancing oxidative and

antioxidative processes in cells, helping to prevent inflammation or

cell damage. Fumaric acids reduce neuronal cytotoxicity, regulate the

peripheral immune response, and inhibit leukocyte migration across

the BBB. Teriflunomid inhibits B and T cell proliferation. Oral

application of teriflunomide reduces exacerbations, decreases MRI

lesion numbers, and slows down MS progression. Cladribine, an oral

immunosuppressant, is used in patients with highly active relapsing

MS. It selectively depletes lymphocytes, reducing the activity and

progression of MS. Fingolimod, approved as the first oral DMD

for patients with relapsing MS, is a sphingosine-1-phosphate (S1P)

receptor antagonist. S1Ps inhibit lymphocyte egress from lymph

nodes, thereby limiting the entry of auto-reactive lymphocytes into the

CNS. Further S1Ps interact with astrocytes and oligodendrocytes,

leading to anti-inflammatory and neuroprotective effects. Studies

have demonstrated that these agents, particularly fingolimod, show a

more significant beneficial impact in reducing exacerbations, slowing

disability progression, and minimizing brain volume loss compared to

first-line treatments such as GA and IFN-β (Amin and Hersh, 2021;

Dargahi et al., 2017).

Four monoclonal antibodies (i.e., alemtuzumab, natalizumab, ocre-

15



lizumab, and ofatumumab) are approved for MS therapy. In detail,

alemtuzumab, a CD52 antibody, depletes B and T lymphocytes

through cytolysis. Natalizumab acts as a monoclonal antibody against

α4-Integrin, efficiently inhibiting the invasion of lymphocytes to the

CNS (Dargahi et al., 2017). Ocrelizumab and ofatumumab are

antibodies against CD20 and deplete B cells, resulting in profound

suppression of disease activity and slowing the development of

disability (Sellebjerg et al., 2020). Mitoxantrones act as a nonse-

lective potent immunosuppressant, used in exceptional situations in

advanced forms of MS or when other DMDs fail.

While DMDs primarily target neuroinflammation, there remains a sig-

nificant gap in therapies that effectively address the neurodegenera-

tive aspects of the disease. Although DMDs reduce relapse frequency

and delay disability progression by modulating the immune response,

they have limited capacity to prevent or repair axonal damage and

neuronal loss, which are key drivers of permanent disability in MS.

Consequently, there is a great need for treatments that promote

remyelination and neuronal repair. Despite ongoing research into

neuroprotective and regenerative therapies, these approaches are still

largely experimental and are not yet part of standard clinical practice.

Addressing these therapeutic gaps is important to improve the long-

term prognosis for MS patients (Dargahi et al., 2017; Reich et al.,

2018).

16



There is a continuously growing field of DMD, with treatment choices

tailored to MS subtype, patient characteristics, and emerging options.

Therefore, treatment guidelines are frequently updated. As an exam-

ple, Figure 4 presents an adapted overview of the current German

recommendation for patients with RRMS (Bayas et al., 2021).

Figure 4: Overview of current treatment recommendations for relapsing-
remitting multiple sclerosis (RRMS) according to German guidelines 2021
(Hemmer, 2023). The figure outlines the first-line, second-line, and
escalation therapies, highlighting approved disease-modifying drugs (DMDs)
and their use based on disease activity and patient characteristics (Bayas
et al., 2021). Image created with BioRender (biorender.com).

The remarkable clinical success of B cell-depleting therapies, such as

ocrelizumab and rituximab, fundamentally shifted the understanding of

17



the pathogenesis of MS - a disease historically considered primarily T

cell-mediated. These therapies reduce antigen presentation and pro-

inflammatory cytokine production by depleting B cells, thus suppress-

ing MS activity and limiting the formation of new CNS lesions. These

findings lead to a reevaluation of immunopathological mechanisms,

emphasizing that B cells contribute via complex interactions to inflam-

mation and tissue damage within the CNS (Hauser et al., 2008; R. Li

and Bar-Or, 2019).

New treatments are being developed to selectively target pathogenic

B cells that drive MS disease progression. A promising approach

includes targeting alternative signaling pathways, such as FGFRs,

which modulate key signaling pathways involved in cell survival,

differentiation, and repair within the CNS (Gurski et al., 2025; Kamali

et al., 2021; Klimaschewski and Claus, 2021; Rajendran et al., 2018).

Additionally, attention was drawn to the inhibition of Bruton’s tyrosine

kinase (BTK), an enzyme central to BCR signaling pathways. BTK

is a critical mediator in pathways such as PI3K, MAPK, and nuclear

factor ’Kappa-Light-Chain-Enhancer’ of activated B cells (NFkB), im-

portant for cell survival, activation, proliferation, and differentiation

into antibody-producing plasma cells (Carnero Contentti and Correale,

2020). BTK inhibitors evaluated in phase II/III clinical trials suggest

their ability to inhibit B cell activation, reduce cytokine production,

and alter APCs functions (Torke and Weber, 2020). Moreover,

18



BTK inhibition demonstrates potential in modulating disease-driving

interactions between B cells and T cells, effectively reducing the

formation of demyelinating lesions within the CNS (Montalban et al.,

2019). However, recent developments in evaluating BTK for MS have

yielded mixed results. For instance, a phase III clinical trial evaluating

the highly selective BTK inhibitor evobrutinib did not meet its primary

objective of reducing annualized relapse rates in patients with RRMS

compared to teriflunomide (Merck KGaA, 2023). However, in another

phase III trial that focused on progressive MS, the BTK inhibitor

tolebrutinib demonstrated a delay in disability progression, suggesting

potential efficacy in this subgroup (Fox et al., 2025). Despite ongoing

challenges, BTK inhibition shows potential, but its effectiveness may

depend on identifying responsive patient subgroups.

In conclusion, although DMDs and B cell-depleting treatments have

already advanced the management of MS, the need for more target

and selective therapies remains. Emerging strategies, including BTK

inhibitors and interventions targeting alternative signaling pathways

like FGFRs, aim to modulate immune responses, prevent neurode-

generation, and promote remyelination, thereby addressing significant

unmet needs in comprehensive MS management (Klimaschewski and

Claus, 2021; Lindner et al., 2015; Rajendran, Böttiger, Dentzien,

et al., 2021; Rajendran, Böttiger, Stadelmann, et al., 2021). These

innovative approaches promise to advance treatment beyond con-

19



ventional anti-inflammatory strategies, offering the potential for more

effective long-term outcomes. Further research is important to

broaden the therapeutic landscape and ultimately find a cure for MS.

Understanding the immune system’s role in MS is key to advancing

treatment strategies, with immune modulation that influences both

disease progression and remission.

1.2 B lymphocytes

The immune system, comprising both innate and adaptive branches,

relies on the balance between these components to maintain home-

ostasis, as dysregulation can lead to immunodeficiency, infections,

allergies, or autoimmunity (Marshall et al., 2018). Inflammation repre-

sents the immune system’s response to tissue damage or pathogens,

driven by immune cell activation and cytokine release, which can lead

to tissue injury when dysregulated (Medzhitov, 2008). Within this im-

munological framework, B cells have become a compelling therapeutic

target due to their multifaceted functions in both immune defense and

disease pathogenesis (Duddy et al., 2007). The following sections will

explore their development, function, and specific involvement in MS

pathology in greater detail.

20



1.2.1 B cell development

B cells originate and develop within the bone marrow, undergoing

tightly regulated maturation processes to maintain immune tolerance.

During this development, B cells encounter a critical mechanism

known as negative selection. This negative selection process iden-

tifies and eliminates autoreactive B cell clones, which mistakenly

recognize and target the body’s own tissue. However, when this

negative selection process is incomplete or defective, autoreactive

B cells may escape into the peripheral circulation, contributing to

the development of autoimmune disorders. In the context of MS,

these autoreactive B cells can infiltrate and harm the CNS (Gururajan

et al., 2014). This mechanism is further explained in Section 1.2.4,

where I describe the specific processes underlying B cell-mediated

neuroinflammation in MS. After passing this checkpoint, immature

B cells leave the bone marrow to migrate to peripheral lymphoid

organs, where they transition into mature follicular and marginal zone

B cells. After these mature B cells interact with their specific antigens,

they differentiate into antibody-secreting plasma or memory B cells.

Mature B cells express CD19, CD20, CD21, CD40, MHCII, and B7

surface proteins, essential for B cell signaling, antigen presentation,

and interactions with T cells. The B cell receptor (BCR), located on

the surface of B cells, is crucial for antigen recognition, as well as

B cell activation and maturation (Abbas et al., 2019; Rastogi et al.,

21



2022). Naive B cells, which are mature B cells, that have not been

in contact with antigens, remain resting until stimulated. In peripheral

lymphoid tissues, another negative selection process is performed to

remove B cells with dysfunctional BCR rearrangements or high affinity

for self-antigens. This second layer of immune tolerance is important

to prevent the survival of autoreactive B cells, potential mediators of

autoimmune diseases like MS (Abbas et al., 2019; Cencioni et al.,

2021).

1.2.2 B cell activation

Naive B cells can be activated through Th cell interaction or inde-

pendently through direct antigen binding. After activation, B cells

differentiate into antibody-secreting plasma cells and memory B cells

(Fig. 5).

In this process, the BCR initiates a signaling cascade (e.g., phos-

phoinositide 3-kinase (PI3K)-protein kinase B (Akt), mitogen-activated

protein kinase (MAPK) signaling pathway) upon binding the antigen.

Additionally, the BCR internalizes the BCR/antigen complex through

endocytosis to intracellular sites for antigen processing. The pro-

cessed antigen fragments are then presented on the B cell surface via

the MHCII receptor, priming Th cells specific to the same pathogen.

Costimulation occurs through the interaction between the CD40 ligand

on effector T cells and the CD40 receptor expressed on B cells,

22



activating the non-canonical NFkB signaling pathway. This interaction

stimulates activated Th cells to secrete cytokines, including IL21,

which enhances B cell division, proliferation, survival, and facilitates

their maturation into antibody-producing plasma cells or memory

B cells. This activation is mediated by the transcription factor

STAT3. On the other hand, B cells can respond directly to non-

protein antigens, including thymus-independent antigens or gram-

negative lipopolysaccharides. These stimuli initiate T cell-independent

activation of B cells, leading to a rapid but transient immune response

characterized by the secretion of unspecific IgM antibodies (Murphy,

2017; Rawlings et al., 2017).

A critical feature of T cell interaction, particularly through the cos-

timulation of the CD40 ligand, is immunoglobulin class switching.

B cells transition from the initial IgM immune response to producing

other immunglobuline isotypes (e.g., IgA, IgE, or IgG). This switch in

immunglobulin isotype occurs within the germinal center of secondary

lymphoid tissues, where somatic hypermutation and affinity maturation

optimize antibody specificity. During this process, B cells undergo

clonal selection, interacting with T cells to refine antigen recognition,

and produce antibodies with higher affinity. Following class switching,

some B cells differentiate into long-lived memory B cells, which are

primed for rapid responses during subsequent exposures to the same

antigen, and secrete isotype-specific antibodies (e.g., IgG) (Murphy,

2017; Rawlings et al., 2017).

23



The activated B cells then circulate between the blood and sec-

ondary lymphoid organs like lymph nodes, the spleen, and mucosa-

associated lymphoid tissue (MALT). Combining class switching and

affinity maturation enables B cells to produce antibodies with higher

specificity and efficacy. However, altered B cell-intrinsic signaling

through the BCR and extrinsic co-receptor signaling pathways, es-

sential to B cell activation, can lead to the survival of autoreactive

B cells. These B cells may secrete pathogenic antibodies or show

autoreactive receptors that bind to self-antigens, contributing to au-

toimmune diseases, highlighting the critical role of tightly regulated

B cell activation in maintaining immune tolerance and preventing

autoimmunity (Murphy, 2017; Parkin and Cohen, 2001; Rawlings

et al., 2017). In the context of neuroinflammation, these dysregulated

B cells infiltrate the CNS and drive inflammation, leading to myelin

degradation and axonal damage. Thus, highlighting the importance of

targeting B cell responses as part of therapeutic strategies to prevent

CNS autoimmunity in MS (Dendrou et al., 2015).

24



Figure 5: Simplified overview of B cell development and activation. B
cell development begins in the bone marrow, where progenitor B cells
undergo genetic rearrangement to create a receptor capable of recognizing
a broad range of antigens. Once matured, naive B cells travel to secondary
lymphoid organs. They are activated upon antigen binding. During T cell-
dependent activation, B cells process and present antigens via MHC II to
T-helper cells, receiving essential costimulatory signals through the CD40-
CD40L interaction and cytokines such as IL-21. These signals trigger
B cell proliferation, class switching, and the maturation into plasma cells
that secrete antibodies, as well as memory B cells. T cell-independent
activation occurs when B cells directly recognize antigens, enabling them to
rapidly produce antibodies without the involvement of T cells, leading to the
formation of resting memory cells and plasma cells that secrete antibodies
(Abbas et al., 2019; Cencioni et al., 2021). Image created with BioRender
(biorender.com).

1.2.3 B cell function

B cells play various roles in immunity. Most importantly, they mediate

humoral immunity through the production of immunoglobulins and

participate in the development of cellular immunity by serving as APCs

for T cells and B cells, which release a range of different cytokines

25



(Cencioni et al., 2021).

These antibodies can either be presented as surface immunoglobulins

on B cells or can be secreted. Further, they activate the classic

pathway of the complement system via C1q binding, and engage

fragment crystallizable receptor (FcR) on immune cells to activate and

recruit macrophages and other immune cells. The immunoglobulin

isotype and the binding affinities to the FcR on immune cells determine

the exerted effector functions (Hoffman et al., 2016). B cells become

activated and potent APCs by presenting specific antigens. This

results in CD4 T cell activation and differentiation through MHCII and

co-stimulatory molecules expressed by B cells, promoting immunity.

As APCs, activated B cells can positively or negatively impact T cell

function, resulting in T cell activation or T cell tolerance (X. Chen and

Jensen, 2008).

In addition, activated B cells release pro- and anti-inflammatory

cytokines (i.e., IL2, IL4, IL6, IL10, IL35, IFNγ, TNFα) and granulocyte-

macrophage colony-stimulating factor (GM-CSF), which modulate

immune responses. Some cytokines have the potential to alter B cell

development by affecting the growth, survival, and class switching of

these cells. B cells can be classified into anti-inflammatory, cytokine-

producing, “regulatory”, and pro-inflammatory cytokine-producing “ef-

fector” B cells. Activated B lymphocytes also release chemokines (i.e.,

CCL22 and CCL17), which are important for Th2 cell recruitment.

Effector cytokines from B cells such as IL6, IFNγ and TNFα induce

26



inflammation (Hoffman et al., 2016; Murphy, 2017; Vazquez et al.,

2015). Further, IFNγ, and TNFα can directly generate endothelial

and epithelial cell injury. In contrast, the production of IL10 or IL35

by B cells exerts regulatory function (regulatory B cell (Breg)) through

modulation of dentritic cells (DCs) (e.g., decrease of IL6 and IL12),

macrophages, NK cells, and T cells (Hoffman et al., 2016).

In addition, described as an in situ immune response, B cells con-

tribute to the formation of tertiary lymphoid organs within peripheral

tissues. These tertiary lymphoid organs typically form in response to

chronic inflammation or ongoing infection and can lead to tissue injury.

This process can be observed in autoimmune diseases. In MS these

lymphoid structures occur mainly within the meninges of the CNS and

are associated with chronic inflammation (Mitsdoerffer and Peters,

2016). B cells play a dual role in immune regulation, contributing

to pathological and protective processes in neuronal damage and

repair. The review article "Heterogeneity of B Cell Functions in

Stroke-Related Risk, Prevention, Injury, and Repair" by Selvaraj

et al. (2016) highlights how B cells influence stroke risk factors,

such as hypertension and atherosclerosis, through pro-inflammatory

actions, while regulatory B cells secrete anti-inflammatory cytokines

like IL10, promoting tissue repair and neuroprotection (Selvaraj et al.,

2016). These findings underscore the ability of B cells to modulate

neuroinflammatory environments, which is particularly relevant in MS.

Figure 6 is an adapted illustration from Selvaraj et al. (2016) of several

27



key functions of B cells in both the immune system and neuroimmuno-

logical processes. It emphasizes the crucial involvement of B cells

in maintaining immune homeostasis and their active participation

in both protective and pathological mechanisms, including immune

responses, neuroprotection, and inflammation. Targeting specific B

cell functions may reduce inflammation and enhance neuronal repair

and remyelination, presenting promising therapeutic strategies for MS

treatment.

28



Figure 6: This image illustrates the multifaceted roles of B cells in both
the immune system and neuroimmunological processes. 1. Antibody
production: B cells, upon encountering specific antigens, differentiate into
plasma cells and produce antibodies (immunoglobulins). 2. Neuronal
survival and differentiation: B cells contribute to neuronal health by
secreting cytokines and growth factors, which promote neuronal survival
and differentiation, particularly in response to central nervous system
injury or neuroinflammation. 3. Immunosuppression: Regulatory
B cells (Bregs), produce anti-inflammatory cytokines, suppressing excessive
immune responses, helping maintain immune tolerance and preventing
autoimmune damage. 4. Inflammation: B cells produce proinflammatory
cytokines and interact with other immune cells, contributing to inflammation
and the development of tissue damage. 5. Memory: Memory B cells
are formed after an initial immune response to an antigen and can rapidly
produce antibodies upon re-exposure. 6. Antigen presentation: B cells
function as antigen-presenting cells, capturing, processing, and presenting
antigens to T cells. This interaction initiates and strengthens adaptive
immune responses (Selvaraj et al., 2016). Image created with BioRender
(biorender.com).

29



1.2.4 B cells in MS

The presence of intrathecal B cells and the resulting abnormal

increase in immunoglobulin synthesis, along with the typical OCB

found in the CSF of patients, imply the involvement of B cells in the

pathophysiology of MS. The positive IgG OCB are diagnostic markers.

However, specific CNS reactive antibodies consistently present within

the CSF across MS patients have not been identified (Antel and

Bar-Or, 2006; Dendrou et al., 2015). OCB may represent immune

responses to neoantigens generated during demyelination rather than

primary autoimmune reactivity. These neoantigens, arising from post-

translational modifications or structural changes in myelin proteins,

may amplify ongoing immune responses (Pryce and Baker, 2018).

Furthermore, cross-reactive antibodies against EBV nuclear antigen

EBNA1 and glial cell adhesion molecule have been found in the CSF of

MS patients, with evidence of viral mimicry contributing to disease ac-

tivity (Lanz et al., 2022). However, beyond antibody production, B cells

drive disease pathogenesis by activating T cells, presenting antigens,

and secreting pro-inflammatory cytokines such as IL6, underscoring

their multifaceted role in driving disease pathogenesis. Memory

B cells from MS patients have the ability to induce spontaneous

proliferation of auto-reactive CD4+ T cells. Activated B cells act as

potent APCs when binding the same antigen as the T cell, resulting in

effector T cell activation and the production of regulatory T cell (Treg)

30



cells. This complex interplay of T and B cells could contribute to

MS pathophysiology (Cencioni et al., 2021; Dendrou et al., 2015).

This possibility is also supported by B cell-specific MHCII knockout

EAE experiments, where mice were resistant to the MOG-induced

disease, suggesting an MHCII dependent APC function of B cells in

EAE (Dendrou et al., 2015; R. Li et al., 2018).

A dysregulation between pro- and anti-inflammatory cytokines is

recognized in patients with MS. Activated B cells produce excessively

cytokines, including TNF, lymphotoxin α, IL6, and GM-CSF. For

example, IL6, known to provoke Th17 cell responses, is believed to

drive the pathogenesis of EAE and MS. GM-CSF secreting B cells are

also considered to be pro-inflammatory through effectively increasing

myeloid cell pro-inflammatory responses and by co-expressing high

levels of IL6 and TNF (Dendrou et al., 2015). On the other hand,

B cells are able to suppress inflammation and the immune response

by producing anti-inflammatory cytokines such as IL10, IL35, and

TGFβ. The selective knockout of IL10 in EAE resulted in more

severe EAE symptoms (Bettelli et al., 1998). Molecular mechanisms

involved in human cytokine regulation by B cells are altered in MS

patients, where more phosphorylation of STAT5 and STAT6 has

been observed, resulting in increased proinflammatory GM-CSF and

decreased production of the anti-inflammatory cytokine IL10. Also,

microRNAs were described to underlie B cell cytokine dysregulation

of MS patients, like the overexpressed miR-132 resulting in increased

31



TNF secretion (Dendrou et al., 2015).

In MS, aberrant activation of peripheral immune cells and their

subsequent trafficking across the BBB into the CNS lead to chronic

neuroinflammation. B cell-rich aggregates of infiltrating immune

cells in the meninges of the CNS were observed in MS patients.

Here, B cells drive compartmentalized inflammation and contribute

to CNS injury by secreting inflammatory and cytotoxic factors into

the CSF, fostering a inflammatory environment within the brain.

These B cell clones are maintained over time within the CNS by

factors like B cell activating factor (BAFF), secreted by astrocytes,

supporting B cell survival and activation. Chronically activated B

cell-rich infiltrates in the meninges are associated with extensive

neuronal, astrocyte, and oligodendrocyte loss and active gray matter

demyelination. Activated and demyelinated cortical lesions with

perivascular immune cell infiltrates are common in early MS (Dendrou

et al., 2015). Further B cell accumulation has been observed

to correlate with a worse clinical disease course, indicating B cell

contribution to CNS inflammation (Cencioni et al., 2021; Dendrou

et al., 2015; R. Li et al., 2018).

1.3 Cytokines

Cytokines are signaling proteins, peptides, or glycoproteins that reg-

ulate immunity, inflammation, and hematopoiesis. They are produced

32



by immune and non-immune cells and act in autocrine, paracrine,

and endocrine manners and can have overlapping, synergistic, or

antagonistic effects. The cytokine superfamily includes interleukins,

chemokines, colony-stimulating factors (CSF), interferons, transform-

ing growth factors (TGF), and TNF. Cytokines can be classified by

their pro-inflammatory (i.e., IL 1, 6, 8, 12, 18, interferons and TGF)

and anti-inflammatory (i.e., IL4, 10, 11, 13 and TNFβ) functions.

Pro-inflammatory cytokines induce fever, inflammation, and tissue

damage by stimulating the synthesis of inflammatory mediators, the

production of acute phase proteins, and the recruitment of immune

cells (Sino Biological, 2023). However, their classification as strictly

pro- or anti-inflammatory is oversimplified, as cytokines such as IL6

can exert both effects depending on the context (Scheller et al.,

2011). Cytokines signal via receptor binding of JAKs or other

tyrosine kinases, leading to intracellular signal cascade activation

predominantly involving molecules like STATs, Src-kinases, protein

phosphatases, and other signaling proteins such as Shc, Grb2, and

PI3K (Sino Biological, 2023).

1.3.1 The role of cytokines in MS

In the CNS, cytokines modulate neurodevelopment, synaptic trans-

mission, and neuronal signaling (Zipp et al., 2023). However, their

dysregulation can lead to neuronal inflammation, neurodegeneration,

33



and demyelination. By producing pro-inflammatory and neurotoxic

factors, cytokines cause neuronal and glial cell damage, promote

immune cell infiltration across the BBB, thereby amplifying neuronal

injury and inflammation (Ramesh et al., 2013). Preclinical studies, par-

ticularly EAE models, have provided valuable information on cytokine

modulation. However, translating EAE findings into MS remains a

significant challenge. The limitations of preclinical models in capturing

the complexity of cytokine networks and the multifaceted pathogenesis

of MS contribute to discrepancies between experimental results and

clinical efficacy (Göbel et al., 2018).

IL6

IL6 is activated during systemic inflammation, regulating innate im-

munity by stimulating acute phase reactant synthesis and directing

leukocyte activation and trafficking (Akdis et al., 2011). In MS,

increased IL6 levels in both serum and CSF have been detected

(Stampanoni Bassi et al., 2020). IL6 compromises the BBB, facilitates

immune cell infiltration into the CNS, and exacerbates inflammation

by recruiting inflammatory cells, activating autoreactive T cells, and

promoting the production of pathogenic antibodies (Vazquez et al.,

2015). IL6 enhances the inflammatory Th17 cell differentiation, thus

stimulating the production of IL6, reactive oxygen species, and nitric

oxide by astrocytes, causing neuronal damage (Serizawa et al., 2021).

IL6 modulates B cell differentiation and antibody production through

34



the JAK-STAT3, PI3K-Akt, and RAS-MAPK pathway. In support of

IL6 crucial role in MS pathogenesis, IL6-deficient mice are resistant to

develop MS similar symptoms in EAE models (Rothaug et al., 2016).

IL12

IL12 is secreted by activated monocytes, macrophages, neutrophils,

microglia, DCs, and B cells (Akdis et al., 2011) and promotes Th1 cell

differentiation and NK cells activation. IL12 primarily signals through

the JAK - (STAT)4 pathway and plays a key role in EAE pathogenesis

(Comabella et al., 1998; Jee et al., 2001). Elevated serum levels

of IL12 are observed in patients with MS and correlate with disease

activity (Wang et al., 2018).

35



TNFα

TNFα is found in active MS lesions and is elevated in the serum

and CSF, correlating with disease severity and progression (Göbel

et al., 2018). TNFα mediates neurotoxicity by promoting gluta-

mate production and inducing oligodendrocyte death in a calcium-

dependent manner (Ramesh et al., 2013). However, it also supports

remyelination. Preclinical studies showed that TNFR1 deficient mice

were partially resistant to EAE, suggesting a potential therapeutic

target. However, TNFα blockade in MS patients worsened the

disease, highlighting its dual role in both neuroinflammation and

remyelination (Göbel et al., 2018).

IFNγ

IFNγ is a cell-signaling glycoprotein critical for innate and adap-

tive immunity. It is a potent activator of macrophages, enhancing

phagocytosis and NK cells to diminish infected target cells. INFγ

downregulates Th2 cell response and stimulates MHCII expression

and antigen presentation in cells. It also promotes class switching of

B cells to IgG3 and exerts synergistic effects of TNF on macrophages.

Often, IFNγ is associated with autoimmune diseases. IFNγ levels are

elevated during active MS, and IFNγ was detected in MS lesions. In

both EAE and MS, inflammation is strongly associated with the Th1

cell response, which produces IFNγ. IFNγ activates the JAK signaling

pathway, which is mainly regulated through the STAT1 pathway (Wang

36



et al., 2018). Studies showed that treatment with IFNγ can aggravate

the disease course of MS patients, on the other hand EAE studies

have suggested a potential beneficial role. IFNγ supports OL survival

and may reduce demyelination through ERK pathway modulation in

EAE (Lees and Cross, 2007).

CCL2 and CX3CL1

Cytokines with chemotactic activities are considered chemokines.

CCL2 is a chemotactic factor that draws monocytes and is associated

with the pathogenesis of diseases with monocytic infiltrates. CX3CL1

is a chemokine ligand of the fractalkine gene family that regulates en-

dothelium leukocyte adhesion and migration (Sino Biological, 2023).

In MS, the specific chemokine CCL2 mediates the recruitment of

inflammatory cells to CNS inflammation sites (Høglund, 2014). CCL2

is overexpressed in active and chronic MS lesions. Here, inflammatory

cells, predominantly astrocytes, secrete CCL2, leading to additional

microglial recruitment and activation. This, as well as inhibiting

mature OL production, results in enhanced demyelination. Studies

on CCL2 serum levels show inconsistent results, but mostly reduced

CCL2 levels in the CSF. This reduction is linked to radiologically

defined MS disease activity, suggesting that CCL2 plays a role in CNS

demyelination and contributes to neurodegeneration in MS (Mahad

and Ransohoff, 2003). Neuronal CX3CL1 modulates microglia-neuron

interactions, promoting survival, synaptic transmission, plasticity, and

37



network maturation (Limatola and Ransohoff, 2014). It regulates

cytokine release from microglia, reducing pro-inflammatory mediators

like TNF, IL1β, IL6, and nitric oxides, offering neuroprotection during

neuroinflammation. Additionally, CX3CL1 may influence neuroprotec-

tion or neurotoxicity by regulating microglial phagocytosis of neurons

(Limatola and Ransohoff, 2014).

1.4 FGFs and FGFRs

The FGFs that signal through FGFRs are ubiquitous in various cell

types (e.g., endothelial cells, fibroblasts, and immune cells like B, and

T cells). They play key roles in maintaining essential physiological

functions such as metabolic and tissue homeostasis, endocrine regu-

lation, development, and injury response (Nobuyuki Itoh and David M.

Ornitz, 2011; Ornitz and Itoh, 2015).

The FGF family consists of 23 members, which are structurally related

signaling proteins with diverse biological roles. These members

are classified into different subfamilies based on their function and

expression patterns. The subfamilies include iFGFs (e.g., FGF11,

FGF12, FGF13, and FGF14), hFGFs (e.g., FGF15, FGF21, and

FGF23) and cFGFs. Notably, FGF15 is absent in humans and its

functional human ortholog is FGF19 (Itoh and Ornitz, 2008).

FGFs function in intracrine, paracrine, and endocrine signaling. In

the paracrine and endocrine pathways, FGFs interact with heparan

38



sulfate proteoglycans (HSPGs) on the cell surface, which facilitate

their interaction with FGFRs. These interactions mediate their sig-

naling effect on target cells. On the other hand, iFGFs exhibit a

distinct mode of action, operating mostly independently of FGFRs.

They function intracellularly and diffuse directly after being produced.

This intracellular signaling pathway includes the binding of FGFs to

intracellular domains of voltage-gated sodium channels, particularly in

the nucleus, leading to distinct downstream effects compared to the

activation of FGFR mediated signaling on the cell surface, which fol-

lows a typical tyrosine kinase mechanism (Beenken and Mohammadi,

2009). Upon FGF binding, fibroblast growth factor receptors (FGFRs)

undergo dimerization, trans-/autophosphorylation, and subsequent

phosphorylation of key downstream molecules, including MAPK/ERK,

PI3K/Akt, PLCγ/PKC, and STAT. While all FGFRs activate these

pathways, they do so with varying intensities (Brewer et al., 2016).

The four FGFRs (FGFR1 to FGFR4) mediate diverse functions

through FGF ligand binding. Each FGFR consists of extracellular,

transmembrane, and intracellular domains. The extracellular region

includes three immunoglobulin-like domains (D1-D3), where D2

and D3 primarily mediate FGF binding. Alternative splicing in the

IgIII domain generates two isoforms, IgIIIb and IgIIIc, which dictate

epithelial or mesenchymal ligand specificity. This splicing pattern

ensures that epithelial IgIIIb isoforms bind mesenchyme-derived

FGFs (e.g., FGF7 and FGF10), while mesenchymal IgIIIc isoforms

39



interact with epithelium-derived FGFs (e.g., FGF2, FGF4 and FGF8).

FGF1 is the exception, activating both isoforms, facilitating broader

FGFR signaling. This selective binding mechanism is essential

for epithelial-mesenchymal interactions. The IgI domain and the

serine-rich acid box linking D1 and D2 play a key role in receptor

autoinhibition. The transmembrane domain connects the extracellular

region to the intracellular tyrosine kinase domains (TKI and TKII),

which contain the catalytic activity (Beenken and Mohammadi, 2009).

Dysregulated FGF signaling can contribute to pathological conditions

through gain and loss of functions of FGF ligands or FGFRs. For

example, pathological FGFR1 signaling through a gain-of-function

mutation has been identified in glioblastoma (Rand et al., 2005).

In craniosynostosis syndromes, kinase domain mutations of FGFR2

were found, and single nucleotide polymorphisms in FGFR2 are

known to play a role in BRCA2 mutation breast cancer (Beenken

and Mohammadi, 2009). Dysregulated FGF signaling is a pivotal

factor in disease development. Advances in molecular biology and

targeted therapy paved the way for innovative treatment strategies

aimed to restore normal FGF function. Further research into the

intricate mechanisms of FGF/FGFR dysregulation will be essential

for developing precision medicine approaches, ultimately improving

patient outcomes in conditions driven by aberrant FGF signaling.

40



1.4.1 FGF/FGFR signaling pathway

The binding of FGF to the FGFR induces receptor dimerization, lead-

ing to cross-phosphorylation of the kinase domains, thus recruiting

downstream effector molecules and activating four key downstream

pathways (i.e., RAS-RAF-MAPK-ERK, PI3K-Akt, JAK-STAT and phos-

pholipase Cy (PLCy)). These FGF/FGFR1 signaling pathways pri-

marily regulate cell proliferation, differentiation, and migration. A key

component of this downstream signaling is the Akt pathway, which

plays a crucial role in controlling cell survival, cell differentiation in

size and growth, and modulating cell metabolism. Additionally, the

downstream effects of Akt signaling contribute to essential cellular

processes, including proliferation, tissue invasion, while also con-

tributing to neovascularization (Altomare and Testa, 2005). The ERK

signaling pathway also plays an important role in cell proliferation,

differentiation, migration, metabolism, growth, and survival. It is also

activated in response to cellular stress and DNA damage, particularly

during inflammatory responses. In the CNS, ERK signaling has a

fundamental impact on brain development, and alterations in this

pathway could lead to neuronal disabilities (cf. Section 1.4.2) (Lavoie

et al., 2020).

In FGF/FGFR signaling, several adapter proteins activate signal

transduction in the downstream pathway. FGFR substrate 2 (FRS2)

plays an essential function as a signaling transducer by binding the

41



juxtamembrane region of the receptor. Phosphorylation of FRS2

enables the recruitment of SOS and Grb2, which together activate

the RAS-RAF-MAPK-ERK pathway. Simultaneously, the growth fac-

tor receptor-bound protein 1 (Grb1) - FRS2 complex initiates the

activation of the PI3K-Akt signaling pathway. Another significant

signaling mediator is PLCy, which hydrolyzes phosphatidylinositol 4,5-

bisphosphate (PIP2) into inositol trisphosphate (IP3) and diacylglyc-

erol (DAG). This reaction triggers protein kinase C (PKC) activation

and intracellular calcium release. PKC then contributes to the RAS-

RAF-MAPK-ERK pathway activation through RAF phosphorylation.

On the other hand, the JAK pathway activates STAT, which then

undergoes dimerization and translocates to the nucleus, to modulate

gene expression (Babina and Turner, 2017). In line with their

involvement in cytokine-driven inflammation and immune responses,

JAK-mediated activation of STAT3, involved in regulating cell survival

and proliferation, can contribute to oncogenesis when dysregulated

(Babina and Turner, 2017; Yu et al., 2009). Ligand binding is a crucial

step in FGF signaling, and this process can be regulated by various

proteins that influence receptor internalization and signaling activity.

Some of these proteins act as negative regulators, modulating the

signaling pathways triggered by FGF ligands. For example, fibroblast

growth factor receptor-like 1 (FGFRL1) and similar expression to FGF

(SEF) are known to reduce the signaling output. Additionally, proteins

such as sprouty (SPRY), Casitas B-lineage lymphoma (CBL), and

42



MAPK phosphatases (e.g., MKP1 and MKP3) regulate the intracellular

signaling cascades by deactivating key components, such as the

MAPK pathways. These regulatory mechanisms ensure a balance in

FGF-mediated signal transduction and prevent overactivation, which

is critical for maintaining cellular homeostasis and preventing patho-

logical conditions (Turner and Grose, 2010).

1.4.2 FGF/FGFR signaling in MS

FGFR signaling is a key regulator of CNS homeostasis, playing a

complex role in neuroinflammation, myelination, and tissue repair

(Klimaschewski and Claus, 2021). FGFRs are widely expressed in

the brain and spinal cord, with FGFR1 predominantly found in neurons

and astrocytes, while oligodendrocytes and microglia express higher

levels of FGFR2 and FGFR3 (M. Lee et al., 2011). Growing evidence

indicates that FGF/FGFR signaling contributes to MS pathogenesis

and its disease model EAE by influencing inflammatory responses and

myelination. Analyses of the brain tissue of MS patients revealed the

involvement of FGFs and FGFRs in the destruction of myelin sheaths

as well as in remyelination (Lindner et al., 2015). Upregulation of

FGF2, primarily expressed in astrocytes and macrophages/microglia,

correlates with cellular inflammation and demyelination. Enhanced

FGF2 expression was found in active lesions, where demyelination

occurs, and in the periphery of chronic lesions (Clemente et al.,

43



2011). FGF2 is also known to play a beneficial role in intrinsic

repair processes by promoting the recruitment and proliferation of

OLs, thereby facilitating early stages of regeneration. However, in

later stages with prolonged activation, FGF2 interferes with their

differentiation, preventing them from maturing, negatively affecting

remyelination. Furthermore, higher levels of FGF2 were found in

the CSF of MS patients compared to a healthy control population,

and levels increased significantly during disease relapse (Clemente

et al., 2011; Rajendran, Böttiger, Stadelmann, et al., 2021; Sarchielli

et al., 2008). Therefore, a correlation between FGF2 expression and

disease severity might exist (Rajendran, Böttiger, Stadelmann, et al.,

2021). Conditional deletion of FGFR1 and FGFR2 specifically in

oligodendrocytes has been shown to reduce myelination, a process

possibly linked to diminished ERK1/2-MAPK signaling (Furusho et al.,

2012; Ishii et al., 2014). Under normal physiological conditions,

FGFR2 appears to play a more significant role in myelination than

FGFR1. Key downstream signaling pathways, such as Akt, mech-

anistic target of rapamycin (mTOR), and ERK, contribute to the

regulation of myelin-related gene expression (Furusho et al., 2017). In

MOG35–55-induced EAE, OL-specific deletion of FGFR1 and FGFR2

resulted in a less severe disease course, characterized by decreased

demyelination and axonal damage (Kamali et al., 2021; Rajendran,

Böttiger, Dentzien, et al., 2021; Rajendran et al., 2018). Furthermore,

immune cell infiltration into the spinal cord, specifically monocytes, T

44



cells and B cells, was markedly reduced in these knockout models,

a finding that was similarly observed when pharmacological inhibition

of FGFR was applied in EAE (Gurski et al., 2025; Rajendran et al.,

2023).

These findings underscore the context-dependent nature of

FGF/FGFR signaling in neural repair and inflammation. The observed

reduction in B cell infiltration further emphasizes the role of FGFR

signaling in regulating B cell responses, suggesting a broader impact

on immune modulation and disease pathology.

1.4.3 Role of FGFs and FGFRs in B cells

FGFs and FGFRs play an important role in B cell development,

especially during early stages in the bone marrow (Moroni et al.,

2002). By interacting with FGFRs, FGFs promote the proliferation

and differentiation of B cell precursors, facilitating their progression

into mature B cells. Additionally, FGFRs help maintain the survival of

mature B cells and regulate their activity during immune responses

(Beenken and Mohammadi, 2009). Aberrations in FGF/FGFR signal-

ing have been found in numerous human diseases, including B cell

associated malignancies (e.g., CLL and multiple myeloma) (Ghosh

and Kay, 2013; Lahiry et al., 2010). Beyond hematologic cancers,

abnormal B cell activity has been observed in numerous solid tumors,

such as breast, colon, lung, prostate, ovarian cancer, and melanoma,

45



where tumors are frequently infiltrated by high numbers of B cells

(Somasundaram et al., 2017). This connection suggests that FGFR

signaling may influence tumor progression and immune regulation

through effects on B cells. In neuroblastoma, high B cell infiltration has

been associated with the recruitment of other immune cells and the

activation of immune-related pathways, strongly correlated with tumor

prognosis (Schaafsma et al., 2021). Given the widespread expression

of FGFRs on B cells, dysregulated signaling may affect their prolifer-

ation, survival, and function, potentially contributing to oncogenesis

by influencing B cell behavior within the tumor microenvironment or

shaping a broader immune response.

FGF2 ligand mediated FGFR activation has been implicated in onco-

genic processes. In melanoma, tumor cells themselves secrete FGF2,

which in turn stimulates B cells to produce inflammatory cytokines,

promoting tumor heterogeneity and resistance to kinase inhibitors

FGF2 (Akl et al., 2016; Somasundaram et al., 2017). This suggests

that tumor-derived FGF2 plays a direct role in shaping the immune

microenvironment to support cancer progression. Given that FGFR

signaling influences immune responses across different tumor types,

similar mechanisms may be relevant in other malignancies where B

cell infiltration and FGFs contribute to disease pathology.

In pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL)

in vitro cell studies, FGF2 stimulation reduced the sensitivity of

leukemic cells to prednisolone therapy, indicating that FGF/FGFR

46



signaling may contribute to treatment resistance. The resistance

was reversed by the FGFR inhibitor AZD4547, indicating a direct

role of the FGF2–FGFR3 in glucocorticoid resistance (Jerchel et al.,

2019). Similarly, elevated vascular endothelial growth factor (VEGF)

and FGF2 levels in acute lymphoblastic leukemia (ALL) have been

associated with enhanced leukemic cell survival and treatment resis-

tance (Faderl et al., 2005). In chronic lymphocytic leukemia (CLL),

constituive activation of receptor tyrosine kinase (RTK) pathways,

including FGFRs, have been observed alongside elevated plasma

levels of FGF2. These signals appear to sustain leukemic B cell

survival as well as resistance to apoptosis (Ghosh and Kay, 2013).

Flow cytometric and western blot analyses of CLL B cells showed

low FGFR1, FGFR2, and FGFR4 expression levels, but FGFR3

expression was markedly elevated, suggesting it as a key driver

of downstream signaling cascades involving common intermediate

signaling molecules such as Src-kinases, PI3K, RAS/RAF, and PLCy,

which activate Akt, ERK, PKC, and STAT that promote cell viability and

resistance to cell death (Ghosh and Kay, 2013; Sinha et al., 2016).

Although these mechanisms are primarily characterized in cancer,

they point to the general potential of FGFR signaling to influence

B cell behavior. In the context of autoimmune diseases such as

MS, where B cells play a central immunomodulatory role, similar

signaling pathways may contribute to altered B cell function or survival.

However, the involvement of the FGF/FGFR axis in B cell-mediated

47



immune regulation in MS remains largely unexplored. Advancing

our understanding of this pathway could uncover novel mechanisms

in B cell-driven diseases and identify new opportunities for targeted

therapies.

1.4.4 Therapeutic approaches of FGFR inhibition

Aberrant FGF/FGFR signaling has been implicated not only in various

cancers, but also in nonmalignant conditions, including immunological,

hematological, and vascular disorders. In this context, aberrant acti-

vation of the FGF/FGFR pathway can drive cell-autonomous behavior,

whereby cells maintain proliferation and survival independently of

external regulatory signals. This intrinsic, self-sustaining signaling

contributes to pathological conditions by enabling continuous growth,

resistance to apoptosis, and altered cellular functions (Dai et al., 2019;

Lahiry et al., 2010). Recognizing the central role of FGF/FGFR signal-

ing in disease has prompted the development of targeted therapeutic

strategies. Among these, small-molecule tyrosine kinase inhibitor

(TKI)s have shown particular promise.

These compounds target the catalytic activity of the cytplasmatic

kinase domain by binding the ATP-binding cleft. TKI therapies achieve

this by selectively targeting FGFR (selective TKI) or targeting several

growth factor receptors (multitargeting TKI). Another group of FGFR

inhibitors is known as antagonistic monoclonal antibodies (mAbs)

48



or peptide inhibitors. They bind to the extracellular region of the

receptor, thereby inhibiting the interaction between FGF and FGFR

as well as preventing receptor dimerization. Another way to suppress

FGF/FGFR interaction is through FGF ligand traps that bind multiple

FGF ligands and receptors, thereby inhibiting signaling (Babina and

Turner, 2017; Chae et al., 2017).

Many novel treatments targeting FGFRs are currently being inves-

tigated in preclinical studies and several clinical trials for differ-

ent cancer types. For instance, erdafitinib has received approval

for the treatment of advanced urothelial carcinoma with susceptible

FGFR mutations or fusions, while pemigatinib and infigratinib are

approved for cholangiocarcinoma with FGFR2 fusions or rearrange-

ments (American Society of Clinical Oncology, 2023). Infigratinib,

AZD4547, and dovitinib are among the promising FGFR inhibitors,

currently under active investigation. Infigratinib, approved for cholan-

giocarcinoma with FGFR2 fusions, is also being explored for its

potential in treating recurrent glioblastoma and other solid tumors

driven by FGFR alterations (Ivy Brain Tumor Center, 2024). AZD4547,

is undergoing evaluation in phase II studies targeting tumors with

FGFR aberrations, including breast, urothelial, and cervical cancer

(Chae et al., 2020). Dovitinib, a multi-targeted kinase inhibitor, is

being tested in clinical trials for its efficacy in castration-resistant

prostate cancer and advanced urothelial carcinoma (Choi et al., 2018;

Milowsky et al., 2014).

49



Knight et al. (2022) suggests that infigratinib and AZD4547 exhibit

promising characteristics for BBB penetration, which may enhance

their efficacy in treating brain tumors (Knight et al., 2022). Given

the evidence of CNS penetration, particularly in regions with BBB

disruption, it is reasonable to assume similar activity for all inhibitors

examined in this study. The following sections will discuss these

inhibitors in greater detail.

1.5 Selective and potent non-selective FGFR tyrosine kinase

inhibitors

1.5.1 Selective FGFR inhibitor - infigratinib

Infigratinib is a highly selective FGFR inhibitor of FGFR1, FGFR2,

FGFR3, and FGFR4 (Dai et al., 2019; Kang, 2021). Infigratinib

binds the ATP-binding cleft of the receptor and inhibits autophos-

phorylation and downstream signaling, resulting in decreased MAPK

activity. In vitro studies with hepatocellular carcinoma models showed

the selective potency of infigratinib inducing apoptosis and vessel

normalization in cells with increased FGFR2-3 expression (Botrus

et al., 2021). Also, infigratinib induced dose-dependent (1.4 µM / L)

apoptosis and revealed antiproliferative/inhibitory effects against a

human leukemia cell line (KG-1 cells) by sufficiently downregulating

FGFR1, pAkt and phosphorylated p70 S6 kinase (pS6K) protein

50



expression (Jiang et al., 2018). In addition to preclinical studies,

infigratinib showed promising antitumor effects in clinical trials, mostly

in solid tumors including FGFR2-fusion cholangiocarcinoma, and

FGFR3-altered urothelial carcinoma (Javle et al., 2021; Pal et al.,

2018). Further, ongoing research suggests that infigratinib has a

therapeutic potential beyond solid tumors. A study by Rajendran

et al. (2023) explored infigratinib’s immunomodulatory effects in EAE

and revealed that infigratinib treatment led to reduced clinical severity,

lowered CNS inflammatory infiltration, and decreased the proportion

of CD19+ B cells in the spleen during the early phase of the

disease, suggesting a potential modulatory effect on peripheral B cells

(Rajendran et al., 2023).

1.5.2 FGFR inhibitor - AZD4547

AZD4547 is a selective, orally available small-molecule inhibitor tar-

geting FGFR1–4 (Gavine et al., 2012). In recent literature, AZD4547

is also known as fexagratinib. For clarity and consistency, this thesis

uses the original development name, AZD4547, which was current at

the time the experiments were conducted and is retained to ensure

coherence and traceability. In vivo, AZD4547 inhibits proliferation

in different cell lines, and demonstrated strong antitumor effects in

preclinical models of tumors with abnormal FGFR signaling. AZD4547

inhibits FGFR downstream signaling, including the MAPK cascade

51



(Gavine et al., 2012). It not only suppresses RAS–MAPK signaling,

but also modulates the PI3K pathway, with some studies observing

mild upregulation of PI3K-associated gene products (Delpuech et al.,

2016). Further the inhibition of ERK, Akt, and S6 have been observed,

with selective increased STAT3 activation in responsive cell lines

(Phanhthilath et al., 2020).

In medulloblastoma cell lines, FGFR inhibition by AZD4547 decreased

proliferation and viability in a dose-dependent manner (between 5 µM

to 50 µM) (Lukoseviciute et al., 2020). Significant dose-dependent

tumor growth inhibition, and survival were also observed in in vitro and

in vivo studies of gastric cancer (Xie et al., 2013). Modest response

rates through application of AZD4547 have been observed in phase

IIa trials of endocrine resistant breast cancer (Coombes et al., 2022).

Notebly, AZD4547 reduced the growth and proliferation of Erythrob-

lastic Leukemia Viral Oncogene Homolog 2 (ErbB2)-overexpressing

human breast cancer cells, and decreased the stem-like properties

of these cells, which are often associated with treatment resistance

(Zhao et al., 2017). Additionally Chae et al. (2017) demonstrated

that AZD4547 had modest efficacy in advanced cancers with FGFR

mutations or fusions. Most research on AZD4547 has focused on

various cancer cell lines, particularly in the context of tumors with

alterations in the FGFR pathway (Babina and Turner, 2017). However,

there is a lack of extensive studies investigating the direct impact

of AZD4547 on immune cells, including B cells, which could open

52



new fields for therapeutic applications beyond oncology (Gurski et al.,

2025).

1.5.3 Multikinase inhibitor - dovitinib

Dovitinib is an oral multikinase inhibitor targeting several receptors

(e.g., FGFRs, VEGFRs, PDGFR-β, CSF-1R, c-Kit, RET, TrkA, and

FLT3). It has been extensively studied in various cancer cell lines

(Liu et al., 2021). For example in breast cancer studies, dovitinib

suppressed cell proliferation in FGFR1- and FGFR2-amplified cell

lines and decreased tumor growth in xenograft models with FGFR1

amplification (André et al., 2013). In endometrial cancer, dovitinib

exhibited significant growth-inhibitory effects, with the strongest impact

observed in cells with FGFR2 mutations. The treatment induced

apoptosis, associated with reduced phosphorylation of the ERK and

Akt signaling pathway (Konecny et al., 2013). In addition, in cellular

models of human colon and colorectal cancer, dovitinib further re-

duced the proliferation and expression of the downstream signaling

molecules pERK and pAkt (Gaur et al., 2014; C. K. Lee et al.,

2015). The interactive mechanisms of FGF/FGFR and VEGF/VEGFR

and, therefore, inhibiting both pathways simultaneously, revealed its

potential to improve treatment efficacy in preclinical cancer studies

(Liu et al., 2021). The inhibition of cellular functions, including

cellular proliferation and survival, by dovitinib previously observed

53



in in vivo studies, are now transferred and used in anti-cancer

treatment. In preclinical and clinical phase I/II tumor studies, dovitinib

demonstrated antitumor activity in renal cell carcinoma, gastric can-

cer, prostate cancer, hepatocellular carcinoma, squamosa cell lung

cancer, endometrial cancer, and breast cancer (Babina and Turner,

2017; Fumarola et al., 2017). These studies highlight dovitinib as a

promising therapeutic agent across various cancer types, yet further

investigation into its mechanisms and clinical applications is needed

(Porta et al., 2015).

54



2 Aims

Recent studies indicate that FGF signaling pathways contribute to

the pathogenesis of MS and its disease models, such as EAE, as

explained in Section 1.4.2. Using a conditional knockout technique,

the Experimental Neuroimmunology Group led by Prof. Dr. med.

Martin Berghoff at Justus-Liebig-University Giessen - where this thesis

was later conducted - found that the deletion of FGFR in OLs resulted

in a less severe disease course, reduced inflammation, myelin loss,

and axon degeneration. Notably, within demyelinating lesions, the

number of T and B cells was downregulated (Rajendran et al., 2018,

Kamali et al., 2021). Complementary pharmacological studies further

showed strong anti-inflammatory effects in infigratinib-treated animals.

These findings suggest that immunomodulatory mechanisms may

occur early during disease onset and treatment, likely within the

peripheral immune system (Rajendran et al., 2023 ).

Building on these findings, I hypothesized in this in vitro study, that

pharmacological inhibition of FGFR would modulate FGF signaling

pathways in B cells, leading to alterations in their proliferation and

functional responses. To investigate this, I characterized the effects

of three different tyrosine kinase inhibitors - AZD4547, infigratinib,

and dovitinib - on FGFR signaling pathways in human BL2 cells.

I analyzed their impact on FGFR1/2 expression, key downstream

55



signaling molecules such as pERK and pAkt, and cytokine production,

with the aim of elucidating how FGF/FGFR signaling modulates B cell

function. Given the established role of FGF/FGFR signaling in both

immune regulation and myelin pathology, investigating its inhibition in

immune cells, particularly B cells, is highly relevant to advance the

understanding of MS pathophysiology and to identify novel targets for

future immunomodulatory therapies.

To address this, the in vitro study was designed with the following

specific aims:

• Evaluate FGFR1 and FGFR2 expression and its downstream

signals (i.e., pERK and pAkt) in BL2 cells after selective FGFR

or multikinase inhibition.

• Assess in vitro BL2 cell proliferation and cytotoxicity under

selective FGFR or multikinase inhibition.

• Investigate the modulation of cytokines by selective FGFR or

multikinase inhibition in in vitro BL2 cells, to better understand

how B cells might contribute to inflammatory processes.

56



3 Materials and Methods

3.1 Cell line

The human Burkitt lymphoma cell line used in this study was derived

in 1979 from the bone marrow of a 7-year-old boy diagnosed with

nonendemic Burkitt lymphoma (DSMZ, 2025). In particular, these BL2

cells are EBV negative. The cells are small and exhibit a round to

irregular shape, growing in suspension with an approximate rate of

cell growth doubling time of 24 hours. These BL2 cells exhibit a MYC-

immunglobuline light chain (MYC-IGL) gene fusion (DSMZ, 2025). In

BTK studies, which are of growing interest for modulating B cell activity

in MS, human Burkitt lymphoma cell lines were successfully used (Chu

et al., 2018; Jeong et al., 2023). Thus, highliting the value of BL2 cells

for evaluating the effects of tyrosine kinase inhibitors.

Table 2: Cell line.

Cell line Provider

BL-2 (human Burkitt lymphoma cells) DSMZ-German Collection of Microorgan-

isms and Cell Culture GmbH

57



3.2 Materials

The tables 3-13 listed below summarize all the resources utilized

in this study. All primers (Tab. 8) were purchased from Eurofins

Genomics, Ebersberg, Germany.

Table 3: Primary antibodies.

Name Species Reactivity Mol.

weight

[kDa]

Method Article

Nr.

Manu-

facturer

GAPDH

(G-9)

Mouse H, M, R 37 WB Sc-

365062

Santa

Cruz

Biotech-

nology,

Pasco

Robles,

CA, USA

FGFR1

(Flg

M2F12)

Mouse H, M, R 48-140 WB Sc-

57132

Santa

Cruz

Biotech-

nology,

Pasco

Robles,

CA, USA

Continued on next page

58



Table 3 – continued from previous page

Name Species Reactivity Mol.

weight

[kDa]

Method Article

Nr.

Manu-

facturer

FGFR1 Rabbit H, M, R 118 IF ab58516 Abcam,

Cam-

bridge,

UK

FGFR2

(Bek

C-8)

Mouse H, M, R 110/120,

50

WB Sc-6930 Santa

Cruz

Biotech-

nology,

Pasco

Robles,

CA, USA

FGFR2 Rabbit H, M, R 145 IF Ab109372 Abcam,

Cam-

bridge,

UK

Phospho-

p44/42

MAPK

(Erk1/2)

Rabbit H, M, R 44/42 WB, IF #4370s Cell Sig-

naling

Tech-

nology,

Danvers,

MA, USA

Continued on next page

59



Table 3 – continued from previous page

Name Species Reactivity Mol.

weight

[kDa]

Method Article

Nr.

Manu-

facturer

Phospho-

Akt

(Ser473)

Rabbit H, M, R 60 WB, IF #4060s Cell Sig-

naling

Tech-

nology,

Danvers,

MA, USA

TNF-α

(D5G9)

Rabbit H 18/25 WB #6945 Cell Sig-

naling

Tech-

nology,

Danvers,

MA, USA

IFN-γ

(XMG1.2)

Rat H, M, R 16 WB MM700 Invitrogen,

Carls-

bad, CA,

USA

IL-6

(D3K2N)

Rabbit H 21/28 WB #12153 Cell Sig-

naling

Tech-

nology,

Danvers,

MA, USA

Continued on next page

60



Table 3 – continued from previous page

Name Species Reactivity Mol.

weight

[kDa]

Method Article

Nr.

Manu-

facturer

IL-12A Rabbit H, M, R 35 WB ab133751 Abcam,

Cam-

bridge,

UK

MCP-1

(CCL2)

Rabbit H 13-15 WB #2027 Cell Sig-

naling

Tech-

nology,

Danvers,

MA, USA

CX3CL1 Rabbit H, M, R 95/100 WB ab25088 Abcam,

Cam-

bridge,

UK

61



Table 4: Secondary antibodies.

Name Method Article Nr. Manufacturer

Anti-mouse IgG HRP-linked WB #7076 Cell Signaling Technol-

ogy, Danvers, MA, USA

Anti-rabbit IgG HRP-linked WB #7074 Cell Signaling Technol-

ogy, Danvers, MA, USA

Anti-rat IgG HRP-linked WB #7077s Cell Signaling Technol-

ogy, Danvers, MA, USA

Alexa Fluor 488 F(ab´)2

fragment of goat anti-rabbit

IgG (H+L)

IF #400884 Invitrogen, Carlsbad, CA,

USA

Table 5: Ladders for western blot.

Marker Article Nr. Manufacturer

PageRulerTM Prestained

Protein Ladder
#26616 Thermo Fisher Scientific, IL, USA

PageRulerTM Plus Prestained

Protein Ladder
#26619 Thermo Scientific, IL, USA

62



Table 6: Kits.

Kit Manufacturer Article Nr. Method

BCA Protein Assay

Kit

Thermo Scientific,

Rockford, USA

23227 Protein

quantification

Cell Proliferation

Reagent WST-1

Roche Applied Sci-

ence, Mannheim,

DE

11644807001 Proliferation assay

Cytotoxicity Detec-

tion Kit (LDH)

Roche Applied Sci-

ence, Mannheim,

DE

11644793001 Cytotoxicity assay

iTaq Universal

SYBR Green

qPCR Supermix

Bio-Rad, CA, USA 1725124 PCR

QuantiTect

Reverse

Transcription

Kit

Qiagen GmbH,

Hilden, DE

205313 Reverse

transcription

RNeasy Mini Kit

(50)

Qiagen GmbH,

Hilden, DE

74104 RNA isolation

SuperSignal West

Pico PLUS Chemi-

luminescent Sub-

strate

Thermo Scientific,

Rockford, USA

34580 Western blot

63



Table 7: Buffers.

Buffer Components Volume

1x SDS-PAGE Running

Buffer

Rotiphorese 10x running

buffer, H2O

100ml, 900ml

10x PBS (1L) pH 7.4 137mM NaCl, 2mM

KH2PO4, 2.7mM KCl,

10mM Na2HPO4, H2O

80g, 2.4g, 2g,

14.4g, 1000ml

10x TBS (1L) pH 7.2 to 7.6 Tris, NaCl, H2O 24.2g, 87.7g,

1000ml

1x TBS-Tween (TBST) (1L)

washing buffer

1xTBS, 0.1% Tween20 1000ml, 1ml

Lysis buffer (250ml) pH 7.4 NaCl, Tris, EDTA, Glycerol,

NP40, NaN3

2.19g, 0.61g,

0.07g, 25ml,

2.5ml, 0.025g

6x SDS-PAGE loading buffer 60mM Tris-HCl (pH 6.8), 2%

SDS, 0.01% Bromophenol

blue, 10% Glycerol, ddH2O,

ß-Mercaptoethanol

36ml, 60ml,

60mg, 60ml,

144ml, 65µL/ml

SDS-PAGE Transfer buffer

(1L)

Rotiphorese 10x running

Buffer, Methanol, ddH2O

100ml, 200ml,

700ml

Blocking buffer for WB (5%

BSA), Bovine Serum Albu-

min

BSA fraction V, TBST 5g, 100ml

Continued on next page

64



Table 7 – continued from previous page

Buffer Components Volume

Blocking buffer for IF (5%

BSA), Bovine Serum Albu-

min

BSA fraction V, PBS 5g, 100ml

10x Trypsin EDTA 10x Trypsin, ddH2O 1g, 10ml

10% Ammonium Persulfate

(APS)

APS, ddH2O 1g, 10ml

10% Sodiumdodecylsulfate

(SDS)

SDS, ddH2O 1g, 10ml

65



Table 8: Primers sequences for the genes of interest.

Gene 5’ → 3’ Sequence

Hu GAPDH Forward ACAACTTTGGTATCGTGGAAGG

Reverse GCCATCACGCCACAGTTTC

Hu FGFR1 Forward CCAAAGACGGTCGTTTAGTGG

Reverse ACAGCCAAAGTAAAGTCAAGGTT

Hu FGFR2 Forward ACAGTTTCGGCTGAGTCCAG

Reverse GGTGTCTGCCGTTGAAGAGA

Hu IL1β Forward ATGATGGCTTATTACAGTGGCAA

Reverse GTCGGAGATTCGTAGCTGGA

Hu IL6 Forward ACTCACCTCTTCAGAACGAATTG

Reverse CCATCTTTGGAAGGTTCAGGTTG

Hu IL12A Forward CCTTGCACTTCTGAAGAGATTGA

Reverse ACAGGGCCATCATAAAAGAGGT

Hu IL21 Forward GGCAAGACCAGTATGAAGAGC

Reverse TGACACTGAAAATGTCGTCGG

Hu CX3CL1 Forward ACCACGGTGTGACGAAATG

Reverse TGTTGATAGTGGATGAGCAAAGC

Hu CCL2 Forward GCAATCAATGCCCCAGTCAC

Reverse GACACTTGCTGCTGGTGATTC

Hu IFNγ Forward TCGGTAACTGACTTGAATGTCCA

Reverse TCGCTTCCCTGTTTTAGCTGC

Hu TNFα Forward GAGACAGATGTGGGGTGTGAG

Reverse AGCTGTCATATTTCCCGCTC

66



Table 9: Treatments used for experiments. AZD4547 refers to the compound
now known as fexagratinib.

Compounds Name Company Cat. No. Treatment

Concentration

AZD4547 ABSK 091 Selleck

Chemicals,

TX, USA

S2801 1 µM

Infigratinib NVP-BGJ398 Selleck

Chemicals,

TX, USA

S2183 1 µM

Dovitinib TKI-258 Selleck

Chemicals,

TX, USA

S1018 1 µM

FGF2 FGF basic/bFGF R&D

Systems,

MN, USA

233-FB 25 ng/mL

DMSO Dimethylsulfoxide Carl Roth,

Karlsruhe,

DE

A994.1 1 ng/mL

67



Table 10: Chemicals used in the experiments.

Compound Manufacturer

10x PBS for cell culture (DPBS) PAN Biotech, Aidenbach, DE (Art.-Nr.

P04-53500)

2-Mercaptoethanol Sigma-Aldrich, Taufkirchen, DE

2-Propanol Sigma-Aldrich, Taufkirchen, DE

Albumin Fraktion V Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

8076.3)

Ammonium persulphate (APS) Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

95923)

Aqua Resist VWR International, Radnor, USA (Cat.-

No. 462-7000)

Blot Stripping Buffer (Restore PLUS

Western)

Thermo Scientific, Rockford, USA (Art.-

Nr. 46430)

Bovine Serum Albumin (BSA) Capricorn Scientific, Ebsdorfergrund, DE

(Cat.-No. BSA-1T)

DAPI staining solution Carl Roth, Karlsruhe, DE

Dimethylsulfoxid (DMSO) Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

A994.1)

DNase free H2O Millipore, Burlington, USA

Ethanol (100%) Otto Fischer GmbH, Saarbrücken, DE

Continued on next page

68



Table 10 – continued from previous page

Compound Manufacturer

Ethanol absolute (≥99.8%) Merck KGaA, Darmstadt, DE (M 32205-

1l-M)

Fetal Bovine Serum (FBS) Gibco, Invitrogen, Carlsbad, USA (Art.-

Nr. 10270-106)

Fluorescence Mounting Medium DAKO Agilent, CA, USA

Glycerol Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

3783.1)

Glycin Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

3790.2)

Glycerin Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

3783.1)

Methanol Merck, Darmstadt, DE

Nonfat Dry Milk Cell Signaling Technology, Danvers, MA,

USA (9999S)

Nail Polish Flormar, Turkey

Paraformaldehyde (PFA) Sigma Aldrich, Taufkirchen, DE

Penicillin Streptomycin as medium

supplement

Gibco, Invitrogen, Carlsbad, USA (Art.-

Nr. 15070-063)

Prolong Gold Antifade Reagent

mounting medium for IF

Cell Signaling Technology, MA, USA

Protease/Phosphatase Inhibitor

cocktail

Roche, Mannheim, DE

Continued on next page

69



Table 10 – continued from previous page

Compound Manufacturer

RNAse free H2O Millipore, CA, USA

Rotiphorese Gel (30% acryl-

bisacrylamide mix)

Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

3029.1)

Rotiphorese 10x SDS-PAGE Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

3060.2)

Roti-Load 1 Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

K929.2)

RPMI Medium 1640 (1x) Gibco, Invitrogen, Carlsbad, USA (Art.-

Nr. 21875-034)

Stacking Gel Buffer pH 6.3 Bio Rad, Munich, DE

Sodium chloride (NaCl) Carl Roth GmbH, Karlsruhe, DE

Sodiumdodecylsulfate (SDS) Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

2326.4)

Tetramethylethylendiamin (TMEDA) Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

2367.3)

Tris HCl Carl Roth GmbH, Karlsruhe, DE (Art.-Nr.

9090.3)

Tris HCl buffer, pH 8.8 (Resolving Gel

Buffer)

Bio Rad, Munich, DE

Tris/Glycine/SDS Buffer 10x Bio Rad, Munich, DE

Trishydroxymethylaminomethan (Tris) Carl Roth GmbH, Karlsruhe, DE

Triton X-100 solution Sigma-Aldrich, Steinheim, DE

Continued on next page

70



Table 10 – continued from previous page

Compound Manufacturer

Trypan Blue Carl Roth GmbH, Karlsruhe, DE

Trypsin-EDTA 0.5% (10x) Gibco, Invitrogen, Carlsbad, USA

Tween 20 Merck KGaA, Darmstadt, DE

Non-fat dry milk Cell Signaling Technology, Danvers, USA

Restore PLUS western blot Stripping

Buffer

Thermo Scientific, Rockford, USA

Table 11: Laboratory consumables.

Consumables Manufacturer

Cellstar 6-well, 12-well and 96-well

Cell Culture Plate

GreinerBioOne, Frickenhausen, DE

Cellstar U-shape with Lid, TC-Plate,

96-wells, sterile

GreinerBioOne, Frickenhausen, DE

Cellstar Plastikpipettes (5 mL,

10 mL, 25 mL)

GreinerBioOne, Frickenhausen, DE

Cellstar cell culture flasks (25 cm2,

75 cm2)

GreinerBioOne, Frickenhausen, DE

Cellstar sterile glass pipettes (5 mL,

10 mL, 25 mL)

GreinerBioOne, Frickenhausen, DE

Combs for SDS gels BioRad, Munich, DE

Micro Centrifuge tube Nerbe plus GmbH, Winsen, DE

Continued on next page

71



Table 11 – continued from previous page

Consumables Manufacturer

Micro Amp Fast Reaction Tubes Applied Biosystems, Darmstadt, DE

Micro Amp 8-Cap Applied Biosystems, Darmstadt, DE

Cryobox Ratiolab GmbH, Dreieich, DE

Cryo Tube TM vials (1.8 mL, 4.5 mL) Sarstedt AG & Co, Nümbrecht, DE

Coverslips (24x36mm, 0.13-0.16

thick)

R. Langenbrinck GmbH, Emmendingen,

DE

Falcon tubes (15 mL, 50 mL) GreinerBioOne, Frickenhausen, DE

Glass Pasteur pipettes (150 mm) Brand, Wertheim, DE

Ministart Syringe Filter (0.2 µm) Sartorius Stedim Biotech GmbH, Göttin-

gen, DE

Micro tube (1.5 mL) SARSTED AG & Co., Nürnbrecht, DE;

Nerbe plus GmbH, Winsen, DE

Pipette tips sterile (10 µL, 20 µL,

100 µL, 200 µL)

Nerbe plus GmbH, Winsen, DE

Filter paper for transblotting BioRad, Munich, DE

Pipette tips (nonsterile) (10 µL,

100 µL, 200 µL, 1000 µL)

SARSTED AG & Co., Nürnbrecht, DE

Eppendorf tubes (1.5 mL, 2 mL) Eppendorf Vertrieb Deutschland GmbH,

Wesseling-Berzdorf, DE

Glass plates for SDS gels BioRad, Munich, DE

Glasswares (different sorts) Schott AG, Mainz, DE; VITLAB, Grossos-

theim, DE

Continued on next page

72



Table 11 – continued from previous page

Consumables Manufacturer

AmershamTM ProtranTM Nitrocel-

lulose blotting membrane (0.2 µm)

GE Healthcare, Buckinghamshire, UK

Microscope Slides R.Langenbrinck GmbH, Emmendingen,

DE

MicroAmp®Fast Reaction Tubes Applied Biosystems, Darmstadt, DE

MicroAmp®Optical Cap Strips Applied Biosystems, Darmstadt, DE

Table 12: Chemicals used in the experiments.

Instrument Manufacturer

Axioplan 2 Fluorescence Microscope Carl Zeiss, Jena, DE

Multiscan EX (ELISA-Reader) Thermo Electron Corporation,

Langenselbold, DE

Casting frame SDS gels BioRad, Munich, DE

Cell culture cabinet NuAire, Plymouth, USA

Centrifuge Universal 32 R Hettich GmbH, Tuttlingen, DE

Centrifuge cell culture Sigma, Osterode am Harz, DE

Centrifuge Universal (cooling) Hettich, Tuttlingen, DE

Consort EV231 Power Supply for

Electrophoresis

Sigma-Aldrich, Steinheim, DE

Microscope for cell culture A. KRÜSS Optic GmbH, Hamburg, DE

Continued on next page

73



Table 12 – continued from previous page

Instrument Manufacturer

Mini-Protean Tetra Cell for SDS-

PAGE

BioRad, Munich, DE

Magnetic stirrer IKA Werke GmbH, Staufen, DE

Nanophotometer Implen GmbH, Munich, DE

pH-Meter (HANNA) Merck KGaA, Darmstadt, DE

Pipette boy Integra Biosciences GmbH, Fernwald,

DE

Pipette different types BIOHIT Proline Plus, Merck KGaA,

Darmstadt, DE; Eppendorf, Hamburg,

DE

Refrigerators and freezers (+4°C, -

20°C, -80°C)

Different companies

SANYO Incubator for cell culture Ewald Innovationstechnik GmbH, Bad

Nenndorf, DE

Scale (New Classic MS) Mettler Toledo, Gießen, DE

StepOne Real-Time PCR System Applied Biosystems, Darmstadt, DE

Vortexer Vortex-Genie2 Heidolph Instruments GmbH & Co. KG,

Schwabach, DE

Water bath Memmert GmbH & Co. KG, DE

Western blotting system BioRad, Munich, DE

Thermomixer (1.5 mL) Eppendorf Vertrieb Deutschland GmbH,

Wesseling-Berzdorf, DE

Continued on next page

74



Table 12 – continued from previous page

Instrument Manufacturer

Trans-Blot SD (Semi-Dry Transfer

Gel)

BioRad, Munich, DE

ECL Chemocam Imager Intas-Science-Imaging Instruments

GmbH, Göttingen, DE

Rotating mixer RM5 Assistant, Sondheim vor der Rhön, DE

Feather Disposable Scalpel Feather, Osaka, JPN

Neubauer Improved Chamber Karl Hecht “Assistant”, Altnau TG, CH

Secure work bench NUAIRE Integra Biosciences, Fernwald,

DE

PCR & qPCR Thermocycler Biometra Bioscience, Analytik Jena

GmbH, Jena, DE

Micro Amp 48-Well Base Applied Biosystems, Darmstadt, DE

Thermocycler MyCycler BioRad, Munich, DE

75



Table 13: Software used for analysis and imaging.

Software Manufacturer

ChemoStar Imager (0.4.18.0, 2016) Intas-Science-Imaging Instruments

GmbH, Göttingen, DE

MacOS Apple Inc., USA

Microsoft Office 2018 Microsoft Corporation, USA

SigmaPlot 10 software Systat, San Jose, CA, USA

Image J software (ImageJ 1.52a) National Institute of Health, USA

StepOne RealTime PCR Software v2.1 Applied Biosystems, Darmstadt, DE

Graph Pad Prism Software Version 9 GraphPad Software, Inc., CA, USA

ZEN software for microscope (Zen 2.3) ZEISS, Jena, DE

3.3 Methods

3.3.1 BL2 cell culture

The human Burkitt lymphoma cells (BL2), provided by the Leibniz

Institute DSMZ (DSMZ-German Collection of Microorganisms and

Cell Cultures GmbH, Braunschweig, DE), were cultured in suspen-

sion. The growth medium consisted of 80% Rosewell Park Memorial

Institute (RPMI-1640) (Gibco, Invitrogen, Carlsbad, USA) medium

supplemented with 20% Fetal Bovine Serum (FBS) (Gibco, Invitrogen,

Carlsbad, USA) and 1% penicillin / streptomycin (Gibco, Invitrogen,

Carlsbad, USA). Cells were seeded in 12-15 ml of growth medium

76



in T75 flasks at a concentration of 0.5 × 106 cells / mL. They were

maintained at 0.5 cells to 2 × 106 cells / mL, growing at 37 °C in

an incubator in a controlled atmosphere, with 95% humidity and

5% CO2. At maximum confluency of 80%, cells were sub-cultured

and resuspended in fresh prewarmed growth medium or used for

experimental treatments.

Thawing and freezing BL2 cells

Cells were stored at -80°C in 2 ml cryotubes and thawed at room tem-

perature. When thawed, the freezing medium was diluted with growth

medium and centrifuged (4 min at 12000 rpm). The supernatant

was then removed, and the spare pallet was gently resuspended in

1 ml of prewarmed growth medium for cell count. Subsequently, the

resuspended cells were added to a 15 ml prewarmed growth medium

in appropriate cell culture flasks. Thawed cells were divided at least

two times before they were used in experiments. For freezing, cells

were collected from the flasks and centrifuged (4 min at 12000 rpm).

The cell pellet was dissolved in a 1.5 ml freezing medium and added

to cryotubes. This freezing medium contained 20% FBS RPMI and

10% DMSO to prevent cell damage while cells were stored at -80°C

or in liquid nitrogen.

Cell counting of BL2 cells

Cells were observed daily for quality control under the microscope

and counted. Notably, the Neubauer improved chamber is suitable

77



for counting cultivated cells and was used regularly to determine

the general growth parameters of the BL2 cells. The cell count

was performed to ensure predetermined cell concentrations for all

experiments. Cell counting with this method used 10 µL of cell

suspension mixed with 10 µL Trypan Blue. This compound helps

distinguish dead cells from living cells because, in contrast to viable

cells, dead cells with damaged membranes absorb the dye. The

four corner squares were used to count the viable cells, following the

scheme in Figure 7. The mean value of the cell count in all four large

squares was multiplied by 104 to determine the cell concentration per

milliliter. The value of the cell concentration per milliliter was then

multiplied by the dilution factor to estimate the total number of viable

cells in the volume of suspension (Gstraunthaler and Lindl, 2021).

78



Figure 7: Cell viability assay conducted using the Trypan Blue exclusion
method and cell counting with a Neubauer improved counting chamber.
The Trypan Blue exclusion assay, steps 1 through 3 were followed for
assessing cell viability. Cell counting was performed under a microscope,
distinguishing between stained dead cells and unstained viable cells. Viable
cells within the large square of the Neubauer improved counting chamber
were counted according to the illustrated orientation diagram. Image created
with BioRender (biorender.com).

3.3.2 Experimental treatment of BL2 cells

For each experiments described in the para