Molecular and phenotypic 

characterization of endophytic Sebacinoid 

strains 

 
 
 
 
 

Dissertation zur Erlangung des Doktorgrades  
(Dr. rer. nat.)  

der Naturwissenschaftlichen Fachbereiche  
der Justus–Liebig–Universität Gießen  

 
 

durchgeführt am  
Institut für Phytopathologie und Angewandte Zoologie  

 
 

vorgelegt von  
M.Sc. Magdalena Basiewicz  

aus Polen  
 
 
 
 

Gießen 2010 
 
 
 

 
 

    Dekan: Prof. Dr Volkmar Wolters 
1. Gutachter: Prof. Dr. Karl–Heinz Kogel  
2. Gutachter: Prof. Dr. Gabriele Klug  



 
 

 



 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

For my Parents and Sister 

Dla moich Rodzicow i Siostry 



 
 

 



 

 I 

Parts of this work have already been published:  
 
 

Zuccaro, A.*, Basiewicz, M.*, Zurawska, M., Biedenkopf, D., and Kogel K.–H. 2009 

Karyotype analysis, genome organization, and stable genetic transformation of the root 

colonizing fungus Piriformospora indica Fungal Genetics and Biology 46, 8,  543–550 

* These authors contributed equally to this work. 

 

 

Papers in preparation 

Basiewicz, M., Weiss, M., Kogel K.–H., Zuccaro, A. Molecular and phenotypic 

characterization of Sebacina vermifera strains associated with orchids and the description 

of Piriformospora glomeralium sp. nov.  



 

 II  



 

 III  

Index 

1. Introduction          1 

1.1 Rhizosphere         1 

1.2 Endophyte          1 

1.3 Sebacinales          2 

1.4 Piriformospora indica        3 

1.5 Genome size estimation and sequencing     4 

1.6 Translation elongation factor 1 alpha (TEF) and glycerol–3– 

phosphate dehydrogenase (GAPDH)      6 

1.7 Extracellular enzymes secreted by fungi     8 

1.7.1 Cellulase         9 

1.7.2 Pectinolitic enzymes        9 

1.7.3 Laccase          9 

1.7.4 Peroxidase         10 

1.7.5 Esterase          10 

1.7.6 Lipase          11 

1.7.7 Proteinase         11 

1.8 Objectives          11 

2. Materials and methods        13 

2.1 Fungal and plant material       13 

2.2 Microscope analysis        16 

2.3 Translation elongation factor1–α gene analysis for Sebacinales  

isolates and environmental samples      17 

2.4 DNA extraction         17 

2.5 Southern blot analysis        18 

2.6 Genome estimation        20 

2.6.1 Real–time PCR        20 

2.6.2 Pulsed Field Gel Electrophoresis      23 

2.7 Plate enzymatic assays        24 



 

 IV  

2.7.1 Cellulase activity        24 

2.7.2 Pectinase activity        24 

2.7.3 Laccase activity        25 

2.7.4 Peroxidase activity        25 

2.7.5 Protease activity        25 

2.8 Spectrophotometric enzymatic assay      26 

2.8.1 Laccase activity        26 

2.8.2 Peroxidase activity        27 

2.8.3 Esterase activity        27 

2.8.4 Lipase activity         28 

2.8.5 Determination of total protein content     29 

2.9 P. indica protoplasts regeneration      29 

3. Results           30 

3.1 Analysis of translation elongation factor 1 alpha gene   30 

3.2 Southern blot analysis        31 

3.3 Genome estimation        33 

3.4 Enzyme activity–plate’s tests       37 

3.5 Spectrophotemetric test of Piriformospora indica    40 

3.6 Piriformospora glomeralium sp. nov. Zuccaro Weiss   

ex multinucleate rhizoctonia       45 

3.7 Protoplast regeneration        46 

4. Discussion          47 

4.1 Sebacinales genome sizes estimation      47 

4.2 P. indica protoplast regeneration      52 

4.3 Biochemical analysis of Sebacinales      53 

5. Summary / Zusammenfassung       59 

6. References          62 

  



Introduction 

 1 

1. Introduction 

 

1.1 Rhizosphere 

Rhizosphere is the zone around plant’s root where the most intensive interactions between 

plant host and bacterial or fungal partners take place. Many fungal interaction are parasitic 

and can lead to diseases, the other ones are mutualistic symbioses which are beneficial to 

host plants. The results of microbial activity in the rhizosphere are changes in root patterns 

and nutrients availability to plants. Direct reactions between members of different 

microbial types often affect promotion of key processes assisting host’s growth and health. 

All interactions occurring around plant roots are, at least indirectly, mediated by plant. 

Many naturally occurring rhizospheric bacteria and fungi are antagonistic toward 

pathogens (Kiely et al. 2006). They compete for colonization or infection sites as well as 

carbon and nitrogen sources. Moreover, pathogens can be inhibited by antimicrobial 

substances, such as antibiotics, secreted by rhizospheric organism. Additional, indirect 

mechanisms improve plant nutrition, modify root anatomy, and lead to changes in 

microbial community in the rhizosphere, and activation of plant defence mechanisms 

(Whipps 2001, Barea et al. 2005). 

 

1.2 Endophyte 

The fungi associated with plants are highly diverse, some of them are endophytes. The 

term fungal endophyte defines a fungus of which at least a significant part of its life cycle 

resides in a plant, and which colonizes tissues without causing symptoms of disease. 

Endophytes from rhizosphere can be easily distinguished from mycorrhizae by lacking 

external hyphal networks and mantels. Fungal endophytes can grow inter– and intra– 

cellulary as well as endo– and epi–phytically (Schulz and Boyle 2005). They are not 

restricted to one environment but were detected in various surroundings including those 

with extreme characteristic (Zhang et al. 2001).  

Endophytic fungal communities adapt to different physiological conditions, in  

consequence they were detected in the wide spectrum of plant tissue types. Many neutral 

fungal endophytes are asleep pathogens which may be activated and cause infectious 

symptoms when the host plant is aged and/or stressed. In addition, plant’s endophitic 

association with fungus can influence environment by determination of plant and microbial 

biodiversity (Clay and Holah 1999). 



Introduction 

 2 

The endophytic microbial communities play an essential role in the physiology of host 

plants. Host, colonized by endophyte, often have more vigour due to secretion of plant 

growth–promoting substances such as indole–3–acetic acid (Ek et al. 1983, Robinson et al. 

1998) or cytokines (Crafts and Miller 1974), and improvement of the hosts’ absorption of 

nutritional nitrogen (Lyons et al. 1990) and phosphorus (Gasoni and Stegman de Gurfinkel 

1997; Malinowski et al. 1999). Additionally, the endophyte partner can extensively 

enhance plants resistance to biotic and abiotic challenges (Latch 1993). These beneficial 

features have been observed in infected plants exposed to several abiotic stress such as 

drought (Cheplick et al. 2000), heavy metals (Monneta et al. 2001), culture medium pH 

lower than optimal (Lewis 2004), high salinity (Waller et al. 2005) as well as a biotic one 

including microbial infections (Lewis 2003, Rodriguez et al. 2004, Waller et al. 2005), 

insect pests (Breen 1994, Vázquez de Aldana et al. 2004) and herbivores attack (Schardl 

and Phillips 1997, Mandyam and Jumpponen 2005).  

 

1.3 Sebacinales  

Sebacinales belong to a taxonomically, ecologically, and physiologically diverse group of 

fungi in the Basidiomycota. They have been identified worldwide and form a broad 

spectrum of mycorrhizal types. This unique phenomenon significantly influence natural 

ecosystems (Weiss et al. 2004, Selosse et al. 2007). Ectomycorrhiza, orchid, ericoid, 

jungermannioid and cavendishoid mycorrhiza are formed by Sebacinales. Ectomycorrhiza 

(ECM) is an association where the fungus forms a hyphal mantle or layer around and 

enters into roots and grows only between cortical cells forming a Hartig net (Agrios 2005, 

Glen et al. 2002, Selosse et al. 2002). Fungi that colonize members of the Orchid family 

belong to the orchid mycorrhiza type. Orchid’s protocorm cells are penetrated by fungal 

hyphae during the saprotrophic stage. In consequence, seedlings can continue their 

development (ed. Trigiano 2003). Ericoid mycorrhiza is formed between fungi, and species 

of the Ericaceae and Epacridaceae. Plants from these families have very fine root systems. 

Fungal hyphae pass through the cortical cells. In the later stadium plant cells are packed 

with intracellular hyphal coils (Schmid et al. 1995). Recently Kottke et al. (2003) proved 

that Sebacinales create symbiotic association with leafy liverworts of the subclass 

Jungermanniidae. Although the liverworts do not form roots, they proposed the name 

‘jungermannioid mycorrhiza’. During mycorrhiza growth, fungal hyphae formed coils in 

the stem cells. In contrast to jungermannioid mycorrhiza build by Ascomycetes no or very 

few ingrowths pegs were found. Cavendishoid mycorrhiza seems to be similar to ericoid 



Introduction 

 3 

mycorrhizas because of the presence of coils in roots, an irregular mantle and weak hyphal 

growth between epidermal cells (Setaro et al. 2006). 

Ultrastructural and microscopical characteristic placed Sebacinales within the wood–decay 

fungi from the order Auriculariales (Bandoni 1984). However, molecular phylogenetic 

analysis change Sebacinales taxonimic position (Weiss et al. 2001). Exidioid basidia 

without clamp connections throughout the fructifications and thickened walls of tramal 

hyphae were detected for both Sbacinales and Auriculariales (Wells and Oberwinkler 

1982). Moreover, phytlogenetic analyses based on nuclear sequence of the large ribosomal 

subunit distinguish two subgroups A and B within that order which differ in their ecology 

(Weiss et al. 2004). Orchid mycorrhizas and ectomycorrhizas belong to subgroup A. The 

second subgroup is more diverse and contains ericoid, cavendishoid and jungermannioid 

mycorrhiza, Sebacina vermifera isolates from autotrophic mycorrhiza, endophytic 

Piriformospora indica and multinucleate rhizoctonia in the sense of Warcup (Weiss et al. 

2004). S. vermifera complex is very absorbing group. They have been characterized as 

growth promoters. Positive influence of those isolates on barley (Hordeum vulgare) was 

demonstrated by Deshmukh et al. 2006. S. vermifera MAFF305830 were characterized as 

the best growth promoter and confered the higher reduction of powdery mildew infection. 

On the other hand, in similar experiments with switchgrass (Panicum virgatum L) the 

longest shoots were produced by the plants inoculated with strain MAFF305828, and the 

longest roots had plants colonized by the strain MAFF305830 (Ghimire et al. 2009). Those 

two Sebacina vermifera isolates were also examined in order to verify fungal development 

in the barley tissue. Tissue penetration patterns as well as hyphal structures observed 

during the expansion of these isolates were similar to those created by P. indica. The only 

differences were detected for the speed of fungal development in planta (Waller et al. 

2008). 

 

1.4 Piriformospora indica 

Piriformospora indica belongs to the order Sebacinales and colonize roots of a broad 

spectrum of mono– and dicotyledonous plants including Arabidopsis thaliana, barley, 

wheat and tobacco (Sahay and Varma 1999, Varma et al. 1999, Waller et al. 2005, Serfling 

et al. 2007). The fungus was discovered in the rhizosphere of the woody shrubs Prosopsis 

juliflora and Zizyphus nummularia in the Indian Thar desert in 1997 (Varma et al. 1998). 

Since then, P. indica scientific interest increased exponentially (38 papers published to 

date, NCBI). Wide range of colonized species, including agronomically important plants, 



Introduction 

 4 

makes it a very promising organism in agriculture. In contrast to AMF, the ability of 

creating symbiosis with Arabidopsis thaliana gives the opportunity for fast and effective 

study of the molecular basis of fungal–plant interaction.  

P. indica enhances growth and yield of plant hosts, protect them against biotic (resistance 

to diseases) or abiotic stress (salt stress) (Rai et al. 2001, Barazani et al. 2005, Waller et al. 

2006). The influences of P. indica on colonized plants mimic to a certain extent 

physiological effects of arbuscular mycorrhizal fungi. Although P. indica is a root 

endophyte, it confers resistance against leaf pathogens (Deshmukh et al. 2006). Similar to 

AMF, the fungus is strictly limited to the cortex, where it develops intracellular coils that 

are different from the arbuscules of AM fungi (Varma et al. 1999). However, by 

comparison to AM fungi, P. indica does not induce plant marker genes known to be 

involved in the arbuscular mycorrhiza formation as for example PT11 phosphate 

transporter or a gene containing peptidoglycan binding LysM domain 1 (Gutjahr et al. 

2008).  

Microscopic investigation of barley plants inoculated by P. indica chlamydospores showed 

fungus enters via root hairs. Germinating chlamydospores, closely attached to the 

rhizodermal cell walls, penetrate the subepidermal cells through intercellular spaces in 

within 12 to 24 hours, where they branch and continue to grow. Fungal hyphae extend their 

growth in rhizodermal and cortical cells at later colonization stages. The fungus also 

penetrates through the basal parts of root hair cells, in which bifurcated hyphae form 

chlamydospores (Deshmukh et al. 2006).  

Further analyses were performed in order to comprehend the response of barley roots to P. 

indica colonization by transcriptional and metabolic profiling. The largest group of 

differentially regulated genes revealed in that study was those involved in plant 

defence/stress responses (Schäfer et al. 2009).  

 

1.5 Genome estimation and sequencing 

The genome comprises the total genetic information of the organism. The rapid 

development of sequencing technologies within last few years makes these tools 

commonly available and allows getting genetic information of whole organism very fast. 

2487 genome sequencing projects are running (state October 2010), 827 of them being 

completed (http://www.ncbi.nlm.nih.gov/genomes/static/gpstat.html). The genomic 

information is essential for better understanding the biochemistry and molecular biology of 

the analyzed organisms.  



Introduction 

 5 

The recognition of mechanisms of genetic variation in the pathogen, for instance, is 

essential for developing effective control measures for the disease. Identification of factors 

responsible for regulation of symbiotic processes (like host recognition and infection, 

control of host defence reaction) will help to understand fungal role in plant development 

and physiology. It allows also to study the ecological significance of symbioses and to 

comprehend the responses of organisms to their natural environments. In addition, genes 

involved in ecological adaptation can be clearly defined.  

The genome size of ectomycorrhizal basidiomycete Laccaria bicolor is aprox. 65 Mb and 

was the largest sequenced Basidiomycete genome (Martin et al. 2008). The availability of 

this genome strongly contribute in deeper understanding the interaction between symbiont 

and plants within their ecosystem, clarify also mechanisms which are used to obtained 

carbon and nitrogen that are essential in plant production. L. bicolour genome analysis 

revealed a large number of small secreted proteins of unknown function. Some of them 

may play a role in initiating symbiosis because they are only expressed in symbiotic 

tissues. Lack of plant cell walls degrading enzymes was observed in L. bicolour genome, 

however, it possess enzymes which can degrade other polysaccharides, suggesting the 

mechanisms used to grow both in soil and in association with plants (Martin and Selosse 

2008). The Perigord black truffle Tuber melanosporum Vittad. (Ascomycota) is the largest 

sequenced fungal genome (aprox. 125 Mb) published so far (Martin et al. 2010). The 

investigations of T. melanosporum genome allow better understanding of the biology and 

evolution of the ectomycorrhizal symbiosis as well as support identification of processes 

that trigger fruit body formation. Beside L. bicolour, Coprinopsis cinerea (Basidiomycota), 

a model organism for mushroom–forming, has also been sequenced (37 Mb) to examine 

multicellular development in fungi. Studies on this fungus based on DNA–mediated 

transformation and RNAi silencing have provided important knowledge on the regulation 

of mushroom fruiting, mating pheromone, and receptor signalling pathways (Stajich et al. 

2010). The genome of arbuscular mycorrhizal fungus (AMF) is also analyzed. The first 

information about global organization of the Glomus intraradices genome was in 2004. 

Hijri and Sanders (2004) predicted G. intraradices genome size 14.07 ± 3.52 Mb. Since 

that time complete annotation and assembling is not finished. Only annotation of the 

mitochondrial genome (70 608 bp) is completed (Martin et al. 2008, Glomus Genome 

Consortium (GGC) Symposium). AMF are unique obligate symbionts. Their hyphae are 

coenocytic and multinucleate therefore organelles and nutrients can be transported over 



Introduction 

 6 

long distances. Moreover, it has been shown that AMF harbour genetically different nuclei 

(Kuhn et al. 2001), making further analysis more complicated. 

The information about genome size can provide clues to evolutionary relationship. The 

new genomic data can give more insights in the genetic background of analyzed fungi and 

allow investigating in details closely related organisms. Genus Filobasidiella for example, 

contains approximately 38 Cryptococcus species. Two of them: Cryptococcus neoformans 

and Cryptococcus bacillisporus are the casual agents of the majority of human and animal 

disease. The Cryptococcus bacillisporus genome is approximately 20 Mb, and it is 

organized in 14 chromosomes. The same number of chromosomes but smaller genome 

approx. 19 Mb has the C. neoformans (Loftus et al. 2005). The haploid genome of the 

other Basidiomycetes pathogenic fungus Puccinia graminis, which causes stem rust in 

small cereal crops such as wheat, oat, rye, and barley is estimated at 80 Mb, organized in 

18 chromosomes. The genome of Puccinia triticina, the causal agent of leaf rust in wheat 

is estimated to range from  100–124 Mb.  

Fungal genomes vary a lot in sizes. Puccinia triticina has the biggest genome size between 

Basidiomycetes described till now (NCBI ENTREZ genome project). On the other hand, 

Malassezia globosa, lipid–dependent yeast belonging to normal human microflora, has the 

smallest genome, approximately 9 Mb (Xu et al. 2007). Some pneumonia agents 

Pneumocystis carinii, Pneumocystis carinii f. sp. hominis, and Pneumocystis carinii f. sp. 

muris, members of Ascomycetes, have even smaller genomes 6.5–8.4 Mb (Sesterhenn et 

al. 2009). 

Before a sequencing project of whole genome will start, its size should be estimated in 

order to deliver important information for proper preparation and costs prediction. There 

are few techniques available which can be used for fungal genome estimation such as: flow 

cytometry, reassociation kinetics, genomic reconstruction, pulsed field gel electrophoresis 

(PFGE), real–time PCR, and confocal microscope. Usually results from at least two of 

them are combined to ensure that prediction is accurate.  

 

1.6 Translation elongation factor 1 alpha (TEF) and glycerol–3–phosphate dehydrogenase 

(GAPDH)  

Translation elongation factor 1 alpha (TEF) gene encode an abundant and highly conserved 

protein which plays an important role in the elongation cycle of protein synthesis in 

eukaryotic cells (Merrick 1992). In eukaryotes, TEF is the second most profuse protein 

after actin, combining 1–2 % of the total protein in normal growing cells (Condeelis 1995). 



Introduction 

 7 

It binds charged tRNA molecules and transports them to the acceptor site on the ribosome 

adjacent to a growing polypeptide chain. TEF can also regulate other processes by 

interaction with cytoskeleton and mitotic apparatus (Ichi–Ishi and Inoue 1995). 

Additionally, studies in the fungus Mucor racemosus have indicated that TEF may play a 

role in morphogenesis (Linz and Sypherd 1987). TEF gene can be present in multiple 

copies in some Ascomycota and Zygomycota, whereas in many of the analyzed 

Basidiomycota genomes it proved to be in single copy (see some examples in Table 1).  

 

Table 1. Copy number of translation elongation factor 1 alpha (TEF) in some Ascomycota, 

Basidiomycota and Zygomycota 

Taxa Class 
TEF copy 
number 

Referencess 

Ashby gossypii Ascomycota 1 (Steiner and Philippsen 1994) 

Aureobasidium pullulans Ascomycota 1 (Thornewell et al. 1995) 

Histoplasma capsulatum  Ascomycota 1 (Shearer 1995) 

Metarhizium anisopliae Ascomycota 1 (Nakazato et al. 2006) 

Sordaria macrospora Ascomycota 1 (Gagny et al. 1997) 

Podospora anserina Ascomycota 1 ( Silar1994) 

Podospora curvicolla Ascomycota 1 (Gagny et al. 1997) 

Trichoderma reesei Ascomycota 1 (Nakari et al. 1993) 

Arxula adeninivorans Ascomycota 2  Rösel and Kunze 1995) 

Saccharomyces cerevisiae Ascomycota 2 (Schirmaier and Philippsen 1984) 

Schizosaccharomyces pombe Ascomycota 3 (Mita et al. 1997)  

Cryptococcus neoformans Basidiomycota 1 (Thornewell et al. 1997) 

Schizophyllum commune Basidiomycota 1 (Wendland and Kothe 1997) 

Puccinia graminis f. sp. tritici Basidiomycota 2 (Schillberg et al. 1995) 

Mucor racemosu Zygomycota 3 (Linz et al.1986) 

 

Glycerol–3–phosphate dehydrogenase (GAPDH) is a key enzyme in both glycolysis and 

glycerol metabolism therefore it has a fundamental role in energy metabolism and biomass 

synthesis (Wei et al. 2004). The enzyme catalyzes the reduction of dihydroxyacetone 

phosphate to sn–glycerol 3–phosphate (Peng et al. 2010). This gene is present as single 

copy in many Basidiomycetes (Table 2), however there are some exceptions such as in 

Agaricus bisporus where two different genes are known. 



Introduction 

 8 

Table 2. Copy number of glycerol–3–phosphate dehydrogenase (GAPDH)) in some 

Ascomycota, Basidiomycota and Zygomycota 

Taxa Class 
GAPDH 
copy 
number 

Referencess 

Aspergillus nidulans Ascomycota 1 (Punt et al. 1988) 

Beauveria bassiana Ascomycota 1 (Liao et al. 2008) 

Saccharomyces cerevisiae Ascomycota 1 (Sprague and Cronan 1977) 

Flammulina velutipes Basidiomycota 1 (Kuo et al. 2004) 

Lentinus edodes Basidiomycota 1 (Hirano et al. 1999) 

Phanerochaete 
chrysosporium 

Basidiomycota 1 (Harmsen et al. 1992) 

Schizophyllum commune Basidiomycota 1 (Harmsen et al. 1992) 

Pseudozyma flocculosa  Basidiomycota 1 (Neveu et al. 2007) 

Agaricus bisporus Basidiomycota 2 (Harmsen et al. 1992) 

Mucor racemosu Zygomycota 3 (Wolff and Arnau 2001) 

 

1.7 Extracellular enzymes secreted by fungi 

The penetration of the external plant layers is an essential task for successful colonization 

of the host tissues by endophytic fungi. This effect can be obtained by either mechanical 

fracture of the protective tissues or by enzymatic digestion. In plant pathogens both 

mechanical and enzymatic components of the penetration mechanism have been at least 

partly demonstrated (Kolattukudy 1985, Howard et al. 1991). Based on the lifestyle and 

genome size of the fungus Idnurm and Howlett (2001) estimated that plant pathogenic 

fungi genomes consist 60–360 virulence or pathogenicity genes. Some of them are 

involved in the infection structure formation, synthesis of toxins or cell wall-degrading 

enzymes (Madrid et al. 2003, Möbius and Hertweck 2009, Werner et al. 2007). Other 

genes are important during establishment of a compatible pathogenic interaction.  

Endophytes occupy the same ecological niche as most pathogens, therefore, it can be 

assumed that they utilize the same strategy employed by pathogens for the penetration of 

the host tissues (Petrini et al. 1992). At the beginning of colonization process, endophytic 

fungi have to achieve at least partial degradation of cell wall. Extracellular enzymes, 

proteins that catalyze different types of chemical reactions, might be one of the main tools 

in that process. Those proteins can be divided into six main groups: oxidoreductases, 

lyases, hydrolases, transferases, ligases and isomerases (http://www.brenda–enzymes.org/, 



Introduction 

 9 

Chang et al. 2009). Fungal cellulases and pectinases can be very active while plant cell 

wall degradation. As a response to intracellular plant protection mechanisms fungal 

endophytes secrete supplementary enzymes such as esterase, laccase, peroxidase and 

proteinase (Burke and Cairney 2002, Ramstedt and Soderhall 1983). 

 

1.7.1 Cellulase 

Cellulase belongs to hydrolases and plays important role in digestion of two major 

components of plant cell walls–cellulose and hemicellulose. Sequence analysis and 

biochemical characterization of cellulase genes have shown that many of them are 

multifunctional proteins. They are composed of distinct domains arranged in several 

combinations. Many cellulase–degrading organisms secrete several enzymes that act 

synergistically (Sandgren et al. 2001). Furthermore, they have evolved a battery of 

enzymes having different specificities with respect to endo/exo mode of action (Beguin 

and Aubert 1994).  

 

1.7.2 Pectinolitic enzymes 

Pectin is a complex of polysaccharides present in most primary cell walls which bind cells 

together by forming gel–like matrix (Wozny 2000). Fungi secrete a various number of 

enzymes to digest pectin which operates through different degradation pathways such as 

deesterification, hydrolysation or depolymerization. This huge range of activities suggests 

the great fungal adaptation to host tissues. Pectinases can also play a role during the 

establishment of ectomycorrhizal symbiosis. However, the level of enzyme production is 

not very high (Garcia–Romera et al. 1991, Ramstedt and Soderhall 1983). Despite that, 

plants produce polygalacturonase–inhibiting proteins (PGIPs) which reduce aggressive 

potential of pectinases and limit fungal invasion. Additionally, the host plant can influence 

fungal enzyme production by pectin content in cell wall. It has been demonstrated that 

pectin content level is higher in Dicots than in Monocots (Jarvis et al. 1988). 

 

1.7.3 Laccase 

Laccase is a blue copper protein which catalyses the reduction of O2 to H2O using a 

number of phenolic compounds as hydrogen donors (Thurston 1994). Laccase contributes 

to lignin degradation by oxidising free phenolic groups to phenoxy cation radicals as well 

as non–phenolic lignin model compounds. This enzyme is associated with morphogenesis 

in some Basidiomycota and Ascomycota strains (Das et al. 1997, Worrell et al. 1986, 



Introduction 

 10 

Rehman and Thurston 1992). Additionally, it is involved in physiological processes related 

to pathogenesis like melanin synthesis essential for survival and longevity of fungal 

propagules (Bell and Wheeler 1986, Edens et al. 1999). The enzyme has been also detected 

in zones of mycelial contact between competing basidiomycetes (White and Boddy 1992, 

Iakovlev and Stenlid 2000). Subsequently, it has been suggested that laccase is involved in 

detoxification of phenols (Haars and Huttermann 1981) and protection against host 

oxidative responses (Edens et al. 1999). Many fungi secrete multiple laccase isozymes, 

encoded by differentially expressed genes that may fulfil different functions. Coprinopsis 

cinerea has two subfamilies of laccases with 15 and 2 nonallelic members, respectively 

(Kilaru et al. 2006). Five laccase genes have been identified in Trametes villosa (Yaver et 

al. 1996). P. indica enzyme activity in axenic culture was demonstrated using laccase 

specific antibody LccCbr2 (Kellner et al. 2007) 

 

1.7.4 Peroxidase 

Peroxidases are enzymes extremely widespread and diversified, present in almost all living 

organisms. They play crucial role in lignin degradation. Fungi secrete two main 

peroxidases: lignin peroxidase (LiP) and manganese peroxidase (MnP). They are heme–

containing glycoproteins which require hydrogen peroxide as an oxidant and they can be 

secreted in several isoenzymes form into the cultivation medium (Hatakka 1994). On the 

other hand plants are also able to exude peroxidases. Class III of plant peroxidases is 

described as group of enzymes involved in a broad range of physiological processes, 

including plant defence (Passardi et al. 2005, Almagro et al. 2009, Gonzalez et al. 2010). 

 

1.7.5 Esterase  

Esterases are enzymes which hydrolyze esters present in biological material of all kinds of 

organisms. A wide spectrum of esterases exists with different substrate specificity, protein 

structure, and biological function, therefore it can be assumed that they have evolved to 

enable access to carbon sources or to be involved in catabolic pathways (Machado and 

Castro–Prado 2001, Bornscheuer et al. 2002). Those enzymes do not hydrolyze long–chain 

fatty acid esters and prefer water–soluble substrates (Bornscheuer et al. 2002). Esterase 

isozyme patterns can be used for taxonomic purposes in plant–fungal interactions, and, 

because of their common expression in varius mycorrhizal fungi, they are also good 

indicators of changes in fungal activity (Sen 1990, Timonen and Sen 1998). Additionally, 



Introduction 

 11 

esterase indicates catabolic activity in soil, which directly correlates with microbial activity 

(Vazquez et al. 2000).  

 

1.7.6 Lipase 

Lipases are esterases which can hydrolyse long–chain tri–aclyglycerides. Lipases can be 

distinguished from esterases by the phenomenon of interfacial activation–high catalytic 

activity which is observed only in the presence of a hydrophobic phase, a lipid droplet 

dispersed in water or an organic solvent. This situation is associated to the presence of a 

hydrophobic oligopeptide protecting the entrance to the active site. In a hydrophobic 

environment, the lid moves aside and the substrate can enter the binding pocket 

(Bornscheuer et al. 2002). The enzyme can be secreted by filamentous fungi, however the 

production depend on the strain, the composition of the growth medium (carbon and 

nitrogen sources, pH) and cultivation conditions (temperature, agitation and dissolved 

oxygen concentration). The enzyme is heat resistant, and plays an important role in the 

breakdown and mobilization of lipids within the cells of an individual as well as transfer of 

lipids from one organism to another (Shukla and Gupta 2007).  

 

1.7.7 Proteinase 

Proteinase belongs to a big family of proteolytic enzymes important in the metabolism of 

all organisms. The main plant cell component such as cellulose and other carbohydrate 

polymers are held together by protein linkages therefore proteolytic enzymes may also 

have a role in fungal invasion of the plant host (Sreedhar et al. 1999). Extracellular 

proteinase from ericoid mycorrhizal endophytes can degrade complex organic substrates 

and provide its host plants nitrogen normally unavailable to them (Leake and Read 1989). 

External pH regulates both activity and production of fungal proteinases (Leake and Read 

1990).  

 

1.8 Objectives 

The main aim of my thesis was molecular and phenotypic characterization of seven strains 

belonging to the order Sebacinales. Generally, Sebacinales have been worldwide identified 

and comprehend a wide spectrum of lifestyles. Nonetheless, only few isolates are cultured 

by  now. The study encompass root endophyte Piriformospora indica, Australian orchid 

mycorrhizae Sebacina vermifera strains and orchidaceous rhizoctonia isolate from pot 

cultures (multinucleate rhizoctonia DAR29830) which were described as plant growth 



Introduction 

 12 

promoters and resistance inducer for abiotic and biotic stress. In order to better understand 

the relationship between Sebacinales isolates and to provide a novel genetic marker for 

molecular environmental analysis we investigated phylogenetic connection among 

Sebacina vermifera isolates, multinucleate rhizoctonia DAR29830, Piriformospora indica 

and three environmental samples from south Germany. Moreover, the closest related 

fungus to P. indica isolated by Williams in the 1984 from a spore of Glomus fasiculatum 

but never classified taxonomically known as multinucleate rhizoctonia was described as a 

new species and named as Piriformospora glomeralium. 

In order to elucidate the molecular processes and identify the fungal factors that lead to a 

successful symbiosis of P. indica and other Sebacinales with its plant partners as well as 

for better understanding the mechanism of the symbiosis, the genome size of mentioned 

fungi was estimated. First, the techniques such as Pulsed Field Gel Electrophoresis (PFGE) 

and real–time PCR was establish for Piriformospora indica genome size estimation and 

further applied for the genome size determination for other fungi belonging to the order 

Sebacinales. Real–time PCR method relies on absolute quantification a one copy gene in 

genomic DNA sample. Therefore TEF gene (translation elongation factor 1 alpha) was 

confirmed to fulfil those conditions in all Sebacinales isolates. Furthermore, to affirm the 

accuracy of this approach the second gene–GAPDH (glycerol–3–phosphate 

dehydrogenase) was used as well. In addition, Saccharomyces cerevisiae was used for 

validation of the method. Southern blot analysis was performed to prove the copy number 

of GAPDH in P. indica genome. Moreover, a  procedure for fungi protoplast preparation 

was developed and the best conditions for its regeneration were evaluated.  

Sebacinales are successful in plant root colonization, therefore, they must secrete 

substances which allow them to enter into the plant organ. Extracellular enzyme can play 

an important role in that process, consequently, the profile of enzymes excreted by 

Sebacinoid strains was characterised. The special emphasis was put on P. indica.  

 



Materials and Methods 
 

 

 13 

2 Materials and Methods  

 

2.1 Fungal and plant material  

Piriformospora indica DSM11827 isolates were obtained from Deutsche Sammlung von 

Mikroorganismen und Zellkulturen, Braunschweig, Germany. Six Sebacina vermifera 

strains (Table 3.) were obtained from the National Institute of Agrobiological Sciences 

(Tsukuba, Japan), multinucleate rhizoctonia DAR29830 was kindly provided by Karl–

Heinz Rexer (University of Marburg, Marburg, Germany). Rhizoctonia solani AG8 was 

supplied by Timothy Paulitz from Washington State University, USA. The haploid 

Saccharomyces cerevisiae genotype BY4741, MATa (ACC. No. Y02321) and the diploid 

S. cerevisiae genotype FY1679, MATa/MATa (ACC. No. 10000D) were received from 

Euroscarf, Frankfurt, Germany. S. vermifera MAFF305837 and S. vermifera MAFF305835 

were propagated on solid or liquid Malt–Yeast–Extract–Pepton medium (MYP) and all 

other Sebacinales isolates as well as R. solani on Complete Medium (CM, Pham et al., 

2004), whereas both S. cerevisiae strains were grown on Yeast–Extract–Peptone–

Dextrose–Adenine medium (YPAD) (Guthrie and Fink 2002). All fungi strains were 

grown at 24 °C in liquid cultures by  shaking t 120 rpm speed. 

 

Table 3. Sebacinales isolates 

Fungus isolate Host name 

P. indica DSM11827 
Prosopis juliflora and Zizyphus nummularia 
(woody shrubs)  

S. vermifera MAFF305830  Crytostylis reniformis (Orchid)  

S. vermifera MAFF305842  Microtis uniflora (Orchid)  

Piriformospora glomeralium ( ex 
multinucleate rhizoctonia DAR29830)  

Trifolium subterraneum 

S. vermifera MAFF305828  Eriochilus cucullatus (Orchid)  

S. vermifera MAFF305837  Caladenia dilatata (Orchid)  

S. vermifera MAFF305835  Caladenia catenata (Orchid)  

S. vermifera MAFF305838  Caladenia tesselata (Orchid)  

 



Materials and Methods 
 

 

 14 

CM medium  
 
  MYP Medium   

20x salt solution 50 ml  Malt–extract 7.0 g  

Glucose 20 g  Peptone (Soya) 1.0 g  

Peptone 2 g  Yeast extract  0.5 g  

Yeast extract 1 g  dest. water 1000 ml  

Casamino acid  1 g  autoclaved   

Microelements  1 ml     

Agar–agar 15 g     

dest. water 950 ml     

autoclaved      
 

20x salt solution     Microelements  

NaNO3 120 g  MnCl2 x 4H2O 6.00 g 

KCl  10.4 g   H3BO3 1.50 g 

MgSO4 x 7H2O 10.4 g  ZnSO4 x 7H2O  2.65 g 

KH2PO4 430.4 g  KI  0.75 g 

dest. water 1000 ml   Na2MoO4 x 2H2O 2.40 mg 

   CuSO4 x 5H2O 130 mg 

   dest. water 1000 ml 
 

YPAD  

Yeast extract  10 g 

Peptone 20 g 

Glucose 20 g 

Adenine hemisulphate 100 mg 

Agar–agar 15 g 

dest. water 1000 ml 

autoclaved  
 

Environmental samples 

Four independent environmental samples (Table 4) collected from two different areas in 

Germany were analyzed. DNA samples were kindly provided by Michael Weiss from 

Tübingen University and they belong to a poll of environmental collection encompassing 



Materials and Methods 
 

 

 15 

DNA isolated from root material. They were used in ITS – 28S rDNA phylogeny in Weiß 

et al. 2010.  

 
Table 4. Environmental isolates 

DNA sample 
number 

host 
plant 

15 Lolium perenne 
65 Medicago lupulina   
80 Anthyllis vulneraria  
41 Rumex acetosa 
 

Barley (Hordeum vulgare L.) cultivar Golden Promise was obtained from the Leibniz 

Institute of Plant Genetics and Crop Plant Research (IPK) in Gatersleben, Germany. Barley 

seeds were surface–sterilized with 6 % sodium hypochloride, rinsed in water and 

germinated for 2 days on sterile filter paper. Afterwards, seedlings were transferred into 

the jars (5 seedlings/jar) and grown on liquid or solid modified plant nutrient medium (1/10 

PNM) under 16h light (47 µmol m–2 s–1) at 24 °C. In order to check enzyme production 

barley plants were inoculated with P. indica or Piriformospora glomeralium. Four–week 

old fungal mycelia were crashed using a fine blender and applied as inoculum. 

 

1/10 PNM    Fe–EDTA  

1M KNO3 0.5 ml   FeSO4 x 7H2O 2.5 g 

0.36M KH2PO4 1 ml   Na2EDTA 3.36 g 

0.14M K2HPO4 1 ml   water 400 ml 

1M MgSO4 x 7H2O 2 ml   bring to boil  

1M Ca(NO3)2 0.2 ml   stir 30 min while cooling 

Fe–EDTA 2.5 ml   bring to final volume 450 ml 

NaCl 1 ml    

Gelrite 4 g    

bring to final volume 1 l with water   

pH 5.6; autoclaved     
 
For spectrophotometric enzymatic tests P. indica was grown on liquid 1/10 PNM with 

shaking 120 rpm. 

 

 



Materials and Methods 
 

 

 16 

2.2 Microscope analysis 

Microscopic analyses were performed in order to estimate P. indica genome size and to 

measure multinucleate rhizoctonia structures. Syto 9 and propidium iodide (PI) 

(LIVE/DEAD® Bac Light™ Bacterial Viability Kit Invitrogen) were applied in that study 

for staining nuclei. 

To determine the nuclear ploidy level of P. indica, chlamydospores were collected from 4–

week–old CM–agar plates with 0.002 % Tween water. Chlamydospores were washed 3 

times with 0.002 % Tween water and resuspend in 0.9 % NaCl to the final concentration of 

109 –1010 spores/ml. S. cerevisiae (1n and 2n) cells were collected by centrifugation from 4 

to 5 days–old liquid culture. In order to remove the medium, they were washed three times 

in 0.9 % NaCl and resuspended in the same buffer to the final concentration of 109 –1010 

cells/ml. The same volume (approx. 250 µl) of P. indica spores and 1n or 2n S. cerevisiae 

cells suspensions were mixed together and stained with 0.5 µl of Syto 9 and PI followed by 

15 minutes incubation in darkness on ice. Afterwards, excess stain was removed by 

washing 3 times with 0.9 % NaCl and resuspended in that buffer. The fungal material was 

spread onto glass slides, covered with cover glass and analyzed under confocal laser 

scanning microscope Leica TCS SP2 (Leica, Bensheim, Germany). Serial optical 

sectioning images were taken (set manually, 0.10 µm steps) for both P. indica and S. 

cerevisiae. Fluorescence of each section of the nucleus was measured using software 

provided with microscope as follow: first the area of each analyzed nucleus was marked 

and its fluorescence was automatically measured by software. This procedure was repeated 

for each section image of analyzed nucleus. Further, the histogram values of fluorescence 

intensity were summed up and used for genome estimation (Cano et al. 1998). S. cerevisiae 

(1n and 2n) was used as standard organism. The histogram fluorescence value of S. 

cerevisiae 2n is higher than the intencity of the haploidnucleus since fluorescence is 

directly proportional to the amount of DNA present. Based on that assumption the genome 

size of P. indica was estimated.  

The diameter of spores as well as hyphal width, number of nuclei per cell and spore of 

Piriformospora glomeralium (ex multinucleate rhizoctonia) were analyzed under 

fluorescent microscope Axioplan 2 (Zeiss SMT, Oberkochen, Germany). P. glomeralium 

spores were collected as described above for P. indica. The P. glomeralium hyphal 

material was collected from 4–week–old liquid culture, washed few times with 0.9 % NaCl 

and stained as described for P. indica spores.  



Materials and Methods 
 

 

 17 

2.3 Translation elongation factor1–α gene analysis for Sebacinales isolates and 

environmental samples  

DNA from environmental samples was amplified using the primer pair tef420f/tef420r 

(Table 6.) with the AccuPrime™ Taq DNA Polymerase (Invitrogen) according to the 

manufacturer’s instructions. PCR for Sebacinales isolates were performed using the primer 

pairs EF1–983f/EF1–2212r, EF1–983f/EF1–1953r, EF1–983f/EF1–2218r (Table 6.). The 

obtained PCR products were cloned using pGEM®–T Easy Vector Systems (Promega 

GmbH, Mannheim, Germany) and sequenced in both directions with the M13f/r primers. 

Two clones from each PCR were sequenced and further analyzed.  

 
2.4 DNA extraction 

DNA was extracted from four week old liquid Sebacinales cultures and two week old S. 

cerevisiae culture using two different approaches. 

 

Doyle & Doyle modified method followed by a CsCl centrifugation 

200–300 mg frozen fungal mycelium were grinded in liquid nitrogen, and incubated in 700 

µl pre–warmed to 65 ºC extraction buffer with β–mercaptoethanol for 20–30 minutes. 

Next, material was washed using 700 µl chloroform/isoamylalkohol (24:1) and centrifuged 

13000 rpm in 4 °C for 15 min. The washing step was repeated one more time. Afterwards 

DNA was precipitated by adding 50 µl 10 M NH4OAc, 60 µl 3 M NaOAc (pH 5.5) and 

500 µl isopropanol. To receive high concentration of DNA, precipitation took place over 

night in 4 ºC. Subsequently, DNA was washed by 500 µl 70 % EtOH/10 mM NH4OAc. 

After ethanol evaporatoin DNA was dissolved in TE buffer. Later CsCl– centrifugation 

cleaning step was performed. 10 g of CsCl was mixed with 500 µl ethidium bromide 

(EtBr) and 5 ml of DNA samples, further 5ml ultracentrifuge tube was fulfill with the 

mixture and centrifuged at 56000 rpm, 20 ºC for 24 h in Beckman XL 70 centrifuge rotor 

VTI 90. After centrifugation the red band DNA stained by EtBr was obtained. Genomic 

DNA band was collected using the needle attached to the syringe. EtBr was removed from 

DNA by repeated extraction using CsCl saturated 2–butanol. Later, DNA was precipitated 

by 1/10 volume of 3 M NaOAc and 2 volume of 100 % EtOH and incubated –20 ºC at least 

1 h. DNA pellet was washed by cold 70 % EtOH. When EtOH evaporated, DNA was 

dissolved in TE or water. 

 

    



Materials and Methods 
 

 

 18 

  Extraction buffer 

1 M Tris–HCl 100 ml 

0.5 M EDTA 40 ml 

NaCl 81.82 g 

CTAB 20 g 

Na2S2O5 10 g 

bring to final volume 1 l with water 

autoclaved  

before use add  

ß–mercaptoethanol 2 ml 

 

FastDNA® Spin Kit for soil (MP Biomedicals, LLC., Illkirch, France) according to the 

manufacturer’s protocol. 

 

2.5 Southern blot analysis 

10 µg of genomic DNA was digested with 30 Units of restriction proper enzyme (Table 5.) 

over night (or at least 10 h) *. Digested DNA was separated on 0.8 % TAE gel. The gel run 

at 35 V in 4 ºC over night. After electrophoresis gel was stained with EtBr and 

photographed. Later the gel was washed twice in 0.25 N HCl for 15 min, rinsed with 

deionised water, and incubated for 15 min in solution T. Then, transferring apparatus was 

assembled. After over night transfer, the membrane was left for drying for 2 h in RT and 

later crosslink (2 x 50 s, 250 mJoule). Next membrane was washed 2 min in 2xSSC buffer 

and prehybridized in prehybridization buffer containing carrier DNA over night in 65 ºC. 

Following, the prehybridization buffer was replaced with hybridization buffer 

encompassing specific, radioactive–labeled probe. Hybridization process took place at 

least 12 h at 65 ºC. Subsequently, the membrane was washed twice with buffer I and buffer 

II. After washing, membrane was saran wrapped, put to the Phosphor Imager box and 

exposed for at least 3–4 h. 

Table 5. Restriction enzymes applied for fungal, genomic DNA digestion. 

organism restriction enzymes 

P. indica DSM11827 Bam HI, Hind III, SacI 

P. glomeralium Bam HI, Hind III 

S. vermifera MAFF305842   Bam HI, Hind III 



Materials and Methods 
 

 

 19 

Solution T   10 x TAE  

0.4 M NaOH 16 g/l  Tris 48.4 g 

0.6 M NaCl 35.06 g/l  acetic acid (glacial) 11.4 ml 

   EDTA 2.92 g 

20xSSC   dest H2O 1 l 

3 M NaCl   pH 8.5  

0.3 M Na–citrate; pH 7.0 Autoclaved  

 

Prehybridization buffer   5xHSB  

H2O 15 ml   PIPES 30.3 g 

5 x HSB 6 ml   disolve in 300 ml dest H2O pH 6.8 

Denhardts III 3 ml    

10 % SDS 3 ml   add  

    5 M NaCl 600 ml 

mixed together and heat to 65 ºC  0.5 M EDTA  40 ml 

    rechecked pH 

add 3 ml of freshly boiled carrier DNA adjust to 1 l with water 

    Autoclaved 

 

carrier DNA  Denhardts III  

   BSA (fraction V) 4 g 

DNA sodium salt from Salmon Testes 125 mg  SDS 20 g 

dest. H2O  25 ml  Ficoll–400 4 g 

   PVP–360 4 g 

heat to boiling  Na4P2O7 x10 H2O 10 g 

store at –20 °C  dissolve in 200 ml H2O  

 

washing buffer I  washing buffer II 

(2x SSC / 1 % SDS)  (1xSSC / 0.5 % SDS) 

      

dest H2O 800 ml  dest H2O 900 ml 

20xSSC 100 ml  20xSSC 50 ml 

10 % SDS 100 ml  10 % SDS 50 ml 



Materials and Methods 
 

 

 20 

Southern probe preparation 

As probe was used 100 ng of DNA (PCR product specific for each analyzed fungus) in 

final volume 25 µl (if it was necessary 1x TE was used as dissolvent). DNA was 

denaturated in 95 ºC for 5 min, subsequently, cooled on ice for 5 min. Labelling beads 

(Amersham Ready– To–Go DNA Labelling Beads [–32P] dCTP) was dissolved in 20 µl 1x 

TE and mixed with denaturated DNA and 5 µl α–dCTP–32P and incubated 30–60 min in 37 

ºC. Afterwards, the α–dCTP–32P which did not incorporate to the probe was cleaned by 

Illustra microspin G–25 columns (Amersham). The column was vortexed very good, its tip 

was broken and it was centrifuged for 1min in 735 rpm in 4 ºC. Supernatant was thrown 

away and 50 µl of sample was loaded on the column and it was centrifuged for 2 min in 

735 rpm in 4 ºC. Labelled probe was denaturated in 95 ºC for 5 min before use, nest kept 3 

min on ice and mixed with pre–warmed hybridization buffer. 

 

Hybridization buffer 

H2O 7 ml 

5 x HSB 3 ml 

Denhardts III 1.5 ml 

10 % SDS 1.5 ml 

mixed together and heat to 65 ºC 

 

* 

After digestion DNA from S. vermifera MAFF305830, S. vermifera MAFF305828 and S. 

vermifera MAFF305842 was precipitated. 1/10 volume of 3 M NaOAc pH 4.8 and 3 

volume of ethanol were added to digested DNA and incubated in –70 ºC for 20 min. 

Following incubation DNA was spun down for 10 min, the pellet was washed with 70 % 

ethanol, and centrifuged one more time. DNA was air–dried and resuspend in water. 

Further, DNA was loaded on agarose gel and further preceded.  

 

2.6 Genome estimation 

2.6.1 Real–time PCR 

Genome size was estimated using real–time PCR. This technique based on absolute 

quantification of one copy gene and needed standard DNA preparation. Therefore, specific 

PCR products were generated for the ribosomal protein S3 gene–RPS3  of the haploid and 



Materials and Methods 
 

 

 21 

the diploid S. cerevisiae as well as for translation elongation factor 1 alpha–TEF of 

Sebacinales and additionally glycerol–3–phosphate dehydrogenase–GAPDH for P. indica 

using the respective outer primer pairs RPS3–F1/R1 (Wilhelm et al. 2003), 

tef420S6f/tef420S6r for S. vermifera MAFF305828 as well as S. vermifera MAFF305842, 

tef420f/tef420r for S. vermifera MAFF305830, and P. glomeralium (Table 6.). Primers 

tef420f/tef420r and gpd383f/gpd383r were applied for P. indica (Table 6.). These PCR 

products contain the binding sites for the nested primers used in real–time PCR analysis. 

Standards were obtained in PCR performed in a Gene Amp® PCR System 9700 PE 

Applied Biosystem thermo cycler in a total volume of 25 µl containing 1x reaction buffer 

(DNA Cloning Service), 2.5 mM MgCl2 (DNA Cloning Service, Hamburg, Germany), 0.5 

U Taq DNA polymerase (DNA Cloning Service), 0.3 µM each forward and reverse primer, 

200 µM each deoxynucleotide (dATP, dCTP, dGTP, and dTTP), and 50 ng genomic 

template DNA. After an initial denaturation step at 95 °C for 5 min, 35 cycles were 

performed as follow: denaturation at 95 °C for 30 s, primer annealing at temperature 

characteristic for each primers (Table 6.) for 30 s, elongation at 72 °C for 1min, and a final 

extension at 72 °C for 10 min. The PCR products were run on the agarose gel, purified 

using the NucleoSpin Extract II (Macherey–Nagel GmbH, Düren, Germany) and eluted in 

water. Quality and quantity of all purified standard DNA samples were determined by 

NanoDrop. 

Quantitative PCR amplifications with the primer pairs PRS3–F2/R2 for both S. cerevisiae 

strains; tef150f/tef150r and gpd–f/gpd–r for P. indica, tef150S1r/tef150S6f for S. vermifera 

MAFF305828, tef150S1f/tef150S1r for S. vermifera MAFF305830 and S. vermifera 

MAFF305842, tef150f/tef150MRr multinucleate rhizoctonia were performed in 20 µl 

SYBR green JumpStart Taq ReadyMix (Sigma–Aldrich, München, Germany) with 350 nM 

oligonucleotides, using an Mx3000P thermal cycler (Stratagene, La Jolla, USA). Each run 

consists of series fresh made five standards (10–fold serial dilutions) and 1 µl of 2–3 

different dilutions of the genomic DNA samples in 2–3 technical repetitions. PCR 

condition for the GAPDH gene were slightly different than for all other genes and primer’s 

pairs: 35 cycles with 30 s at 95 °C, 1 min at 57 °C, 30 s at 72 °C and 58 °C, 1 min at 72 °C 

and a final extension at 72°C for 10 min. Real–time PCR performed for PRS3–F2/R2 and 

all tef primers were conducted: initial denaturation for 10 min at 95 °C, followed by 35 

cycles with 30 s at 95 °C, 1 min at temperature characteristic for each primers (Table 6.), 

30 s at 72 °C and a final extension at 72 °C for 10 min. The melting curve was examined 



Materials and Methods 
 

 

 22 

every run at the end of cycling to ensure amplification of only a single PCR product. Ct 

values were assigned by the Mx3000P V2 software (Stratagene, Heidelberg) provided with 

the instrument. The estimation of the genome size based on the C values was determined as 

described before by Wilhelm et al. (2003). In short, the size of one haploid genome (C 

value) was calculated from the ratio of the mass of template DNA (m–determined by UV 

absorbance) and the copy number of the target sequence (N–determined by real time PCR), 

C = m/N. The genome size was calculated by Γ = (C x NA)/MBp where NA is Avogadro’s 

number (6.022 x 1023 mol–1) and MBp is the mean molar mass of a base pair (660 g mol–1). 

 

Table 6. Sequences of primers used in that study  

 

primer 

name 
sequence 5'–3' Tm 

tef420f gctgattgcgctatcctcat 55 °C 

tef420r cttgacctccttcgaccatc 55 °C 

tef420S6f gctgattgcgccattctcat 57 °C 

tef420S6r cttgttttccttggtccatc 57 °C 

tef150f tcgtcgctgtcaacaagatg 58 °C 

tef150r accgtcttggggttgtatcc 58 °C 

tef150MRr accgtcttggggttgtagcc 58 °C 

tef150S1f tcgtcgccgtcaacaagatg 58 °C 

tef150S1r acagtcttggggttgtatcc 58 °C 

tef150S6f tcgtcgcgtcaacaagatg 58 °C 

EF1–983f gcyccygghcaycgtgayttyat 62 °C 

EF1–2212r ccracrgcracrgtytgtctctcat 62 °C 

EF1–1953r ccrgcracrgtrtgtctcat 62 °C 

EF1–2218r atgacaccracrgcracrgtytg 62 °C 

gpd383f ctcgacaagtacgacccaca 55 °C 

gpd383r gcattcctgaagacgatacg 55 °C 

gpd–f gattgaaatcttggccgtca 58 °C 

gpd–r ttgccgtcctttacttcgac 58 °C 

RPS3– F1 cgctgacggtgtcttctac 55 °C 

RPS3– R1 cggaaacaacttcacaa 55 °C 



Materials and Methods 
 

 

 23 

RPS3– F2 ccaaccaagaccgaagttat 57 °C 

RPS3– R2 gacagcggacaaacca 57 °C 

M13f gttttcccagtcacgac 55 °C 

M13r aacagctatgaccatga 55 °C 

 

2.6.2 Pulsed Field Gel Electrophoresis 

In order to separate fungal chromosomes on the PF agarose gel protoplasts were produced. 

Four–week–old fungal cultures were crashed using a fine blender. 200 ml of liquid CM 

were inoculated with 1 ml of homogenate and incubated for 2 days at 24 ºC with shaking. 

Then the mycelium was collected by filtration through sterile miracloth (Merck, Eurolab, 

Darmstadt, Germany), washed few times using 0.9 % NaCl and incubated 1 h at 37 ºC in a 

protoplasting solution. Later, protoplasts were filtered through a miracloth and washed 

three times with cold STC buffer. To prepare chromosomal DNA the pre–wormed 

protoplast suspension was mixed with equal volume of 1.8 % BioRad pulsed field certified 

agarose gel at 55 ºC. The solidified plugs were incubated in proteinase K buffer for 12 h 

and washed three times with washing buffer. This step was repeated two times. Plugs were 

stored in washing buffer at 4 ºC. Experiments were performed on a Bio–Rad CHEF DR III 

apparatus. The run conditions are detailed in Table 7. After electrophoresis gels were 

stained with 0.5 µg/ml of ethidium bromide and photographed. Chromosomal DNA from 

S. cerevisiae (Bio–Rad) and Schizosaccharomyces pombe (Bio–Rad) were used as size 

standards. 

 

Protoplasting solution   SMC 

Lysing Enzymes from Trichoderma harzianum 
(L1412 Sigma, Deisenhofen, Germany)  

2%  1.33 M sorbitol 

SMC    50 mM CaCl2 

   20 mM MES buffer 

STC   pH 5.8 

1.33 M Sorbitol in TC    

   Proteinase K buffer 

TC   10 mM Tris 

50 mM CaCl2   1 mM EDTA pH 8.5 

10 mM TrisHCl  pH=7.5   1 % Na–N–laurylsarcosinate  

 



Materials and Methods 
 

 

 24 

Table 7. PFGE running condition for each analyzed fungus. (T–temperature)  

organism condition 
agarose 
concentration in 
the gel 

running 
buffer 

T 

block 1 48 h 2 V 1–1800 s angel 100° 

block 2 48 h 2 V 1–2000 s angel 106° S.vermifera 
MAFF291366 

block 3 24 h 6 V 1–120 s angel 120° 

0.8 % gel TBE 0.8xTBE 14 °C 

block 1 48 h 2 V 1–1800 s angel 100° 
P. glomeralium 

block 2 48 h 2 V 1–2000 s angel 106° 
0.8 % gel TAE 0.8xTAE 4 °C 

block 1 69 h 2 V 1–1800 s angle 100º  
P. indica 

block 2 48 h 2 V 1–2000 s angel 106° 
0.8 % gel TAE 1xTAE 14 °C 

block 1 48 h 2 V 1–1800 s angel 100° 

block 2 48 h 2 V 1–2000 s angel 106° 

S.vermifera 
MAFF305842 
S.vermifera 
MAFF305828 block 3 24 h 6 V 1–120 s  angel 120° 

0.8 % gel TAE 0.8xTAE 4 °C 

 
 
2.7 Plate enzymatic assays 

Tests for extracellular enzymes activity were performed in triplicates following the 

methods describe in Kreisel and Schauer (1987). Mycelial plugs were cut from the edges 

of colonies on 7 days old culture and were used as inoculum for all plate tests. The 

extracellular enzymes activities were analyzed after two weeks. 

 

2.7.1 Cellulase activity 

Fungi were cultivated on medium enclosed 2.5 % malt extract, 1 % cellulose (SERVA, 

FEINBIOCHEMICA, Heidelberg, Germany) and 2 % agar. The enzyme activity was 

checked by spreading Lugol’s solution (2 % iodine and 4 % potassium iodide in water, 

both Sigma, Deisenhofen, Germany). The clear area in the medium around the colony 

indicated cellulose degradation. 

 

2.7.2 Pectinase activity 

To investigate pectinase activity fungi were propagated on the plates where 0.1 % yeast 

extract with 1.5 % agar was enriched by 0.5 % pectin (Roth, Karlsruhe, Germany). Plates 

were evaluated by flooding them with 1 % solution of hexadecyltrimetylammonium 



Materials and Methods 
 

 

 25 

bromide (Sigma, Deisenhofen, Germany) around the growing mycelium. The clear zone 

around colonies suggested that fungus digested the substrate. 

 

2.7.3 Laccase activity 

To check laccase activity, medium contained 2.5 % malt extract and 2 % agar (MAE) was 

used. A dark blue coloration after 3, 24 or 72 h after spreading of 0.1 M α–naphthol 

(Sigma, Deisenhofen, Germany) in 96 % ethanol on the surface of the growing mycelium 

indicated extracellular laccase activity. Along, the laccase production was tested during 

interspecific interactions. For this purpose cocultures of the Sebacinoid strains with the 

root pathogen R. solani were examinated. Sebacinoid isolates grew slower than R. solani 

therefore they were precultured on MAE medium for one week before inoculation. The 

enzyme activity was inspected after one week co–culture as described above. Additionally 

laccase activity of P. indica and P. glomeralium was verified in coculture with barley 

roots. Barley plants were inoculated with 105 chlamydospores. Furthermore, barley mock–

treated, autoclaved barley roots inoculated with chlamydospores and barley inoculated 

with autoclaved fungal mycelium were analyzed. Presence of an enzymatic activity was 

proved five and seven days after chlamydospores inoculation by spreading of 0.1 M α–

naphthol. 

 

2.7.4 Peroxidase activity 

Fungi grew as described by the laccase test. After 2 weeks, attendance of peroxidase was 

evaluated by flooding plates with a fresh– prepared mixture of 0.4 % H2O2 (Roth, 

Karlsruhe, Germany) and 1 % pyrogallol (Sigma, Deisenhofen, Germany) dissolved in 

water. Plates were checked after 3, 24 or 72 h after substrate applying. A dark yellow / 

brown color around the mycelium indicated peroxidase activity. 

 

2.7.5 Protease activity 

Analyzed fungi grown on medium containing 8 % gelatine (VWR PROLABO, Darmstadt, 

Germany) dissolved in water at pH 6. The fungal ability to liquefy the solid media 

indicates proteases production. The test was read after 5, 7, 10, 12 and 14 days growth. For 

excluding any additional not enzymatic gelatine degradation plates were kept for 24 h at    

4 °C.  

 



Materials and Methods 
 

 

 26 

2.8 Spectrophotometric enzymatic assay 

For spectrophotometric assay barley plants as well as P. indica were grown in liquid 1/10 

PNM. In order to obtain autoclaved barley roots, two weeks old barley plants were 

harvesting and roots were autoclaved 20 min at 120 °C. Plant material was inoculated with 

crashed P. indica mycelium. The samples were collected 1, 1.5, 2, 3, 5, 7, 10 and 15 days 

after inoculation.  For each enzyme activity measurement, medium from a culture were 

assembled and filtered through miracloth. To remove the small particles like 

chlamydospores, it was purified once more using membrane filter with pore diameter 0.45 

µm (Whatman, Dassel, Germany) as well. Subsequently, the collected material was 

concentrated with centrifugal devices for biomolecular separation (MACROSEP 10K 

OMEGA PALL Life Sciences, Mexico) according to the manufacturer’s protocol. The 

collected supernatant was utilized for further analysis.  

All tests were carried out in BioTek Synergy 2 Multi–Mode Microplate Reader. 

 

2.8.1 Laccase activity (Harkin and Obst 1973) 

Laccase activity was detected using 2, 2’azino–bis–3–ethylbenzthiazoline–6–sulphonic 

acid (ABTS) (Sigma, Deisenhofen, Germany) as a substrate in sodium tartrate buffer pH 3. 

The enzyme activity was measure immediately after preparing reaction mixture. The 

absorbance was read at 420 nm in 30 °C for 15 min. One unit of enzyme activity was 

defined as the amount of enzyme required for oxidation of 1 µmol ABTS in 1 min.  

 

Reaction mixture 

0.05 M Sodium Tartrate buffer pH 3 50 µl 

5 mM ABTS 100 µl 

culture filtrate 100 µl 

 

The enzyme activity was calculated using the formula below: 

  
d  ε   V

F  V  ∆E
 L U

ABTSEn

totalnm 420 1-

⋅⋅
⋅⋅

=
 

∆E420nm  – absorbance per minute 

Vtotal        – the total volume of reaction mixture (0.25 ml) 

F   – dilution factor  

VEn           – the volume of culture (0.1 ml) 



Materials and Methods 
 

 

 27 

ε ABTS   – extension of coefficient 0.0432 L µmol–1 cm–1  

d          –  the distance the light travels through the material – layer thickness (0.7)    

 

2.8.2 Peroxidase activity (Childs and Bardsley 1975) 

Peroxidase activity was measured using a modified procedure describe for laccase activity 

above. The enzyme activity was checked using ABTS in sodium tartrate buffer pH 3 with 

hydrogen peroxide H2O2 (Sigma, Deisenhofen, Germany) as an additional substrate.The 

enzyme activity was measured immediately after preparing reaction mixture. The one unit 

of enzyme activity was defined as above. 

 

Reaction mixture 

0.05 M Sodium Tartrat buffer pH 3 50 µl 

5 mM ABTS 100 µl 

2 mM H2O2 100 µl 

culture filtrate 100 µl 

 

The enzyme activity was calculated using formula below: 

  
d  ε   V

F  V  ∆E
 L U

ABTSEn

totalnm 420 1-

⋅⋅
⋅⋅

=  

∆E420nm –  absorbance per minute 

Vtotal   – the total volume of reaction mixture (0.35ml) 

F  – dilution factor 

Ven           – the volume of enzyme (0.1ml) 

ε ABTS   – extension of coefficient 0.0432 L µmol–1 cm–1    

d  – the distance the light travels through the material – layer thickness (0.7)    

 

2.8.3 Esterase activity 

Para– nitrophenylacetat (pNPA) (Sigma, Deisenhofen, Germany) was used as a substrate 

for esterase activity determination. The enzyme activity was measured immediately after 

preparing the reaction mixture. The absorbance was read at 405 nm in 30 °C for 15 min. 

One unit of enzyme activity was defined as the amount of enzyme required to hydrolyze 1 

µmol para– nitrophenylacetat per 1 min at pH 6.5. 

 



Materials and Methods 
 

 

 28 

Reaction mixture 

80 mM potassium phosphate buffer pH 6.5 50 µl 

10 mM pNPA 100 µl 

culture filtrate 100 µl 

 

The enzyme activity was calculated using formula below: 

  
d  ε   V

F  V  ∆E
 L U

pNPAEn

totalnm 405 1-

⋅⋅
⋅⋅

=  

∆E405nm –  absorbance per minute 

Vtotal  – the total volume of reaction mixture (0.25ml) 

F – dilution factor 

VEn – the volume of enzyme (0.1ml) 

ε pNPA  – extension of coefficient 0.0183 L µmol–1 cm–1    

d –  the distance the light travels through the material – layer thickness (0.7)    

 

2.8.4 Lipase activity (Winkler and Stuckmann 1979) 

Lipase activity was determined using 4–nitrophenyl–palmitate (4NPP) (Sigma, 

Deisenhofen, Germany) as a substrate in the potassium phosphate buffer pH 8.8. The 

enzyme activity was measured immediately after preparing the reaction mixture. The 

absorbance was read at 410 nm in 37 °C for 15 min. One unit of enzyme activity was 

defined as the amount of enzyme required to hydrolyze of 1 µmol 4–nitrophenyl–palmitate 

per 1 min in pH 8.8. 

Substrate preparation (4NPP – buffer) 

4NPP 15 mg 

isopropanol 5 ml 

sonification for 5–10 s  

  

Deoxycholic acid Na salt (Roth, Karlsruhe, Germany) 110 mg 

Gum Arabic (Roth, Karlsruhe, Germany 50 mg 

potassium phosphate buffer pH 8.8 45 ml 

  

10 min sonification  

 



Materials and Methods 
 

 

 29 

Reaction mixture 

4NPP – buffer  100 µl 

culture filtrate 50 µl 

 

The enzyme activity was calculated using formula below: 

  
d  15min   V

60min  ∆E
 L U

En

366nm 1-

⋅⋅
⋅

=  

∆E366nm – absorbance per minute 

Vtotal  – the total volume of reaction mixture (0.25 ml) 

VEn  – the volume of enzyme (0.1 ml) 

d  – the distance the light travels through the material – layer thickness (0.7)    

 

2.8.5 Determination of total protein content 

The protein content of all analyzed samples was determinate using Bradford assay. The 

protein amount in each sample was estimated by reference to standard curve for bovine 

serum albumin (BSA) (Sigma, Deisenhofen, Germany) in the range 5–120 µg/ml. All 

samples were analyzed in triplicate. 

 

Reaction mixture 

Bradford solution (Roth, Karlsruhe, Germany) 200 µl 

culturefiltrate / standard (BSA) 50 µl 

 

2.9 P. indica protoplasts regeneration 

P. indica protoplasts were prepared as described in the PFGE part. In order to examine the 

best condition for their regeneration few osmotic stabilizers were tested. The complex 

medium as well as top agar was supplemented by 0.3 M sucrose, 0.6 M sorbitol or 0.6 M 

mannitol. The same concentration of protoplasts was mixed with liquid top agar and spread 

on the bottom agar containing the same stabilizers. Regenerations took place at 28 °C and 

every 24 h protoplasts regeneration was checked.  

As controls water and STC were included in the regeneration tests. After 7 days 

regeneration efficiency was compared by counting the growing colonies.    



Results 
 

 

 30 

3 Results 

 

3.1 Analysis of translation elongation factor 1 alpha gene  

The translation elongation factor 1 alpha (TEF) gene was chosen for the phylogenetic study of 

Sebacinales. Additionally to Sebacinales isolates, three independent environmental samples, 

collected from two different areas in Germany, were analyzed with Sebacinales specific 

primers. The sequences of the two TEF gene introns were the same for all environmental 

clones sequenced but different from the Sebacinales isolates (Fig. 1.). The phylogenetic 

analysis placed them close to P. indica showing that closely related fungi are present in 

Germany (Fig. 1.). TEF phylogenetic analysis demonstrates that P. glomeralium (ex 

multinucleate rhizoctonia) is the closest related strain to P. indica from all the Sebacinales 

isolates available at present (Fig. 2.). The phylogenetic studies divided Sebacinales into three 

separated clades (Fig. 4.). The first clade includes S. vermifera MAFF 305837 and S. 

vermifera MAFF 305838, clade 2 is represented by P. glomeralium together with P. indica 

and the third one contains  S. vermifera MAFF 305842, S. vermifera MAFF 305830, and S. 

vermifera MAFF305828. 

 

 
Fig. 1. Alignment of Sebacinales TEF gene including environmental samples demonstrates 

differences in one of introns in that gene. Pr. i.–Protomyces inouyei; S.v.–Sebacina vermifera 

(number indicate the strain); MR–P. glomeralium DAR29830; P.i.–Piriformospora indica; 

15, 65, 80–environmental samples 

 



Results 
 

 

 31 

 

Fig. 2. TEF gene based phylogenetic analysis of P. indica related fungi 

 

3.2 Southern blot analysis 

Southern blot analyses were performed to verify copy number of the TEF gene in Sebacinales 

genomes. Additionally, the P. indica GAPDH gene was investigated. Genomic DNA digested 

with restriction enzymes was separated on agarose gel, transferred on nylon membrane and 

further hybridized with specific radioactive labelled probe. The results obtained for P. indica 

showed only one band for both analyzed genes proving  that they are single copy (Fig. 3). The 

same enzymes combination (Bam HI, Hind III and Sac I) was implement for examination of 

TEF gene copy number in the other Sebacinales strains: P. glomeralium and S. vermifera 

MAFF305828 (Fig. 4.). S. vermifera MAFF 305830 have also only one copy of that gene 

(Zuccaro unpublished data). After genomic DNA digestion of S. vermifera MAFF305842 

with Hind III and hybridization with specific probe multiple bands were detected. However 

after DNA digestion with Bam HI only one band was observed (Zuccaro unpublished data). 

 

 



Results 
 

 

 32 

 

Fig. 3. Study of TEF (A) and GAPDH (B) genes copy number using southern blot approach. 

Genomic DNA was digested by three different enzymes and hybridized with specific 

radioactive labelled probe. Bam HI, Hind III and XbaI were used for TEF gene and Bam HI, 

Hind III and Sac I were applied for GAPDH. 

 

 
Fig. 4. Study of TEF gene copy number in P. glomeralium (A) and S. vermifera  

MAFF305828 (B) using southern blot approach. Genomic DNA was digested by two 

different enzymes–Bam HI (1), and Hind III (2) and hybridized with specific radioactive 

labelled probes.  

 

Furthermore, P. indica chromosomes separated by PFGE were transferred onto nylon 

membrane and hybridized with a probe specific for GAPDH and TEF. GAPDH and TEF 

produce one single band on the PFGE and were located on the third and on the first 

chromosome respectively (Fig. 5.). The smallest band detected on the gel was verified as 

mitochondrial DNA (Fig. 5.). 



Results 
 

 

 33 

PFGE      GAPDH          mit              TEFPFGE      GAPDH          mit              TEF

 

Fig. 5. Localization of GAPDH and TEF genes and identification of the mitochondrial DNA 

on P. indica chromosomes using southern blot technique. PFGE–chromosomes separated 

using PFGE, GAPDH, TEF–localization of analyzed genes, mit–mitochondrial DNA. 

Southern blot analysis was performed using specific radioactive probes.  

 

3.3 Genome estimation 

Two different techniques were used to estimate the genome size of five Sebacinoid strains: 

real–time PCR and Pulsed Field Gel Electrophoresis (PFGE). Additionally, confocal 

microscopy technique were applied for P. indica.  

The real time PCR method based on the absolute quantification of one copy gene in genomic 

DNA sample. S. cerevisiae was chosen as control standard organism. The genome size 

predicted using that approach and applying primers specific for the Saccharomyces cerevisiae 

ribosomal protein S3 gene (ScRPS3) in four independent experiments was in the range of the 

known genome size for this organism (12 Mb, Table 8.). The efficiency of real–time PCR for 

S. cerevisiae was 94 ± 2 %. Relying on the analysis of other Basidiomycota genomes two 

genes TEF and GAPDH were expected to be single copy in the Sebacinales genomes. 

Southern blot analysis using specific probe for those two genes proved that they are single 

copy therefore they were applied for P. indica genome size calculation. Using TEF gene in 

eight independent real time PCR runs from CsCl purified DNA, the haploid genome size for 

P. indica was 15.6 Mb ± 2.75 (Table 8.). Using the second gene GAPDH in four independent 

runs the obtained genome size value of 15.3 Mb ± 3.5 (Table 8.). The real–time PCR 

efficiency for the TEF and GAPDH genes was 100 ± 3 % and 94 ± 2 % respectively. The P. 



Results 
 

 

 34 

indica genome size estimation obtained from DNA samples extracted with FastDNA®SPIN 

Kit for soil yielded was 24 Mb ± 2.5. For the other fungi analyzed in that study only one gene 

TEF were applied. The genome sizes of analyzed Sebacinales isolates are presented in      

Table 10. 

In both extraction methods the 260/280 ratio which has high sensitivity of protein 

contamination in DNA sample was in the optimal range of 1.9 for all analyzed fungi. 

However, the 260/230 ratio showed a contamination by organic compounds for the DNA 

extracted with the kit. The absence of both non–specific PCR products and primer–dimer 

accumulation were approved by the negative controls and melting curve analyses executed 

with each PCR. 

 

Table 8. Sebacinales genome size estimation using real–time PCR based quantification of 

TEF gene and chromosomes number analysis. D&D and CsCl–genomic DNA extracted by 

Doyle and Doyle modified method followed by CsCl cleaning step; Kit–genomic DNA 

estracted using FastDNA® Spin Kit for soil. *–S. cerevisiae chromosomes number was not 

derminated in that study (Goffeau et al. 1996) 

Sebacinales strain 
DNA extraction 
method 

Genome size (Mb)+/– 
standard deviation (Mb) 

Minimal 
chromosomes 
number based 
on PFGE 

D&D and CsCl 12.5±2 S. vermifera 

MAFF305842 Kit 21±4 
5 

D&D and CsCl 11±1.5 S. vermifera 

MAFF 305830 Kit 20.7±1.9 
5 

D&D and CsCl 18.5±1.2 S. vermifera  

MAFF305828 Kit 26±1 
4 

D&D and CsCl 15 ± 3 
P. indica (TEF) 

Kit 24 ± 2.5 

P. indica (GAPDH) D&D and CsCl 15.3 ± 3.5 

6–7 

D&D and CsCl 15.8±2.6 
P. glomeralium 

Kit 22±1.1 
5 

S. cerevisiae (1n) D&D and CsCl 10.3 ± 1.8 16* 

S. cerevisiae (1n) Kit 13 ± 1 16* 

S. cerevisiae (2n) D&D and CsCl 11.5 ± 1 16* 



Results 
 

 

 35 

To separate fungal chromosomal DNA using PFGE different conditions were applied (see 

Table 7.). In all runs chromosomes sizes were calculated over the standards S. cerevisiae and 

Sch. pombe. The molecular karyotype of P. indica determined by that technique demonstrated 

a pattern of six faint chromosomal bands ranging in size from 1.3 Mb to 5.4 Mb. The genome 

size of the merged P. indica electrophoretic bands calculated from three different gels was 

predicted to be about 15.8 Mb ± 0.3. The appearance of chromosomes larger than 5.4 Mb was 

verified by extension of electrophoretic conditions (Fig. 6.). The zone, where big 

chromosomes were expected, was fully resolved and no additional bands were detected. The 

gel after PFGE indicated at least 5 chromosomal bands for S. vermifera MAFF305830, 

MAFF305842 and P. glomeralium and at least 4 for S. vermifera MAFF305828. Similar to P. 

indica, S. vermifera MAFF305830 and P. glomeralium have one big chromosome in the range 

of 5.4 Mb. The gels indicate that S. vermifera MAFF305842 and S. vermifera MAFF305828 

have at least one chromosome bigger than the biggest chromosome of size marker–Sch. 

pombe (5.7 Mb) (Fig. 6.). Moreover, the smallest chromosome for S. vermifera MAFF305842 

and S. vermifera MAFF305828 was still bigger than 2.2 Mb. P. indica and P. glomeralium 

have an additional small chromosome in the range of 1 Mb. The estimation of genome size 

relied on electrophoretic separation of chromosomes conferred a minimal size of 17 Mb for S. 

vermifera MAFF305830, 14.4 Mb for P. glomeralium, 22.3 Mb for S. vermifera 

MAFF305842 and 19.6 Mb for S. vermifera MAFF305828. The strength signal of the gel 

staining with ethidium bromide for S. vermifera MAFF305842 and S. vermifera 

MAFF305828 propose the presence of a higher number of chromosomes which were not 

separated under the tested conditions (Fig. 6.). Although varied condition was applied the 

separation was not improved. 

 



Results 
 

 

 36 

 

Fig. 6. Separation of P. indica (Pi), P. glomeralium (MR), S. vermifera MAFF305830 (S1), S. 

vermifera MAFF305842 (S2), S. vermifera MAFF305828 (S6) chromosomes by Pulsed Field 

Gel Electrophoresis (PFGE). M1–Saccharomyces cerevisiae (Bio–Rad) and M2–

Schizosaccharomyces pombe (Bio–Rad) size standards. 

 

P. indica genome size was additionally estimated using confocal scanning microscope (Fig. 7. 

and Fig. 8). Fluorescence histogram of 12 nuclei stained with syto 9 in chlamydospores was 

measured. By comparison to the fluorescence of Saccharomyces cerevisiae (1n and 2n) which 

nuclei were stained under the same condition, the genome of analyzed fungus was predicted. 

The value of the mean histogram for P. indica was placed in between that of the two S. 

cerevisiae strains suggesting that P. indica genome range 17–22 Mb what confirmed results 

obtained by pulsed field gel electrophoresis and real–time PCR. 

 

 

Fig. 7. Value of mean histogram fluorescence for P. indica and S. cerevisiae strains. P.i.–P. 

indica, S.c. (2n)–S. cerevisiae (2n) and S.c. (1n)–S. cerevisiae (1n) 

 



Results 
 

 

 37 

 

Fig. 8. Fluorescence staining by Syto 9 of Saccharomyces cerevisiae 2n (A) and 1n (B), and 

nuclei of a chlamydospore of P. indica (C). 

 

3.4 Enzyme activity–plate’s tests 

Six Sebacina vermifera isolates collected from different autotrophic orchids in Australia 

(Warcup 1988) and P. indica isolated from woody shrubs in the Indian Thar desert (Varma et 

al. 1998) were analyzed. To study the biochemical variations between isolates, they were 

grown in different media to check extracellular enzyme production. The enzymes profiles of 

the analyzed Sebacinales strains are presented in Table 9. In fact, all of the isolates showed 

strong protease activity. The strongest peroxidase activity presented S. vermifera MAFF 

305842 (Table 9. and Fig. 11.), whereas the higher amount of laccase was produced by S. 

vermifera MAFF 305830. Surprisingly, P. glomeralium and P. indica demonstrated no or 

small activity of those two enzymes. Nonetheless, cellulose activity was detected only for P. 

indica and P. glomeralium under the tested conditions (Fig. 12.). Laccase production was 

further investigated and all fungi were co–cultured with Rhizoctonia solani. P. glomeralium 

and P. indica did not show enzyme activity also under this condition while other Sebacinales 

showed strong laccase production in response to R. solani (Fig. 10.). Subsequently, laccase 

secretion of P. glomeralium and P. indica was analyzed under presence of living as well as 

autoclaved barley roots. The presence of barley roots affected laccase production in P. indica 

(Fig. 13.). The enzyme production was not indicated in P. glomeralium by nor living neither 

autoclaved barley roots. 

 

 

 



Results 
 

 

 38 

Table 9. Enzymatic test (peroxidase, laccase, protease, cellulase and pectinase activity) and 

growth rate on MAE and gelatine of various Sebacinales isolates. +++++ high activity; + low 

activity; – lack of activity. The number indicate colony diameter in mm. 

organism peroxidase laccase protease cellulase pectinase 
MAE 
[mm] 

gelatine 
[mm] 

S. vermifera 
MAFF 305835 

++ ++++ ++++ – + 10–14 32±1.4 

S. vermifera 
MAFF 305837 

++ ++++ +++++ – – 9.5±0.4 47±0.8 

P. glomeralium – – ++++ ++ – 67 ±3.6 41±3 

P. indica 
AY505557 

+ – ++++ ++ – 58±1.4 29±4 

S. vermifera 
MAFF 305830 

+++ +++++ ++++ – – 60±2.5 34±3.6 

S. vermifera 
MAFF305828 

– ++++ ++ + – 32±2.7 13±0.8 

S. vermifera 
MAFF 305842 

++++ + +++ – – 12±1.2 23±1.4 

 

 

Fig. 9. Laccase plate’s enzymatic test. As a substrate 0.1 M α–naphthol was used. The dark 

violet colour indicates enzyme activity. A–S. vermifera MAFF305835 B–S. vermifera 

MAFF305837, C–P. glomeralium, D–P. indica AY505557 E–S. vermifera MAFF 305830, F– 

S. vermifera MAFF305828, G–S. vermifera MAFF305842. 

 

Fig. 10. Laccase production induced by co–culture with R. solani. On the left side of each 

plate R. solani grew and on the right Sebacinales strain. As a substrate 0.1 M α–naphthol was 

used. The dark violet colour indicates enzyme activity. A–S. vermifera MAFF305835 B–S. 

vermifera MAFF305837, C–P. glomeralium, D–P. indica AY505557 E–S. vermifera MAFF 

305830, F–S. vermifera MAFF305828, G–S. vermifera MAFF305842. 



Results 
 

 

 39 

 

 

Fig. 11. Peroxidase plate’s enzymatic test. As substrates were used 0.4% H2O2 and 1% 

pyrogallol. The brown colour indicates enzyme activity. A–S. vermifera MAFF305835 B–S. 

vermifera MAFF305837, C–P. glomeralium, D–P. indica AY505557 E–S. vermifera MAFF 

305830, F–S. vermifera MAFF305828, G–S. vermifera MAFF305842. 

 

 

Fig. 12. Cellulase plate’s enzymatic test. Fungi grew on medium containing cellulose. As 

substrate was used Lugol’s solution. The bright zone around colonies indicates enzyme 

activity. A–P. indica AY505557, B–P. glomeralium, C–S. vermifera MAFF305842, D–

positive control: MAE with cellulose treated with the lysing enzyme from Trichoderma 

harzianum, E–negative control: MAE with cellulose. 

 

 

Fig. 13. P. indica laccase secretion induced by co–culture with H. vulgare. α–naphthol (0.1 

M) was usedas substrate . The dark violet colour indicates enzyme activity. A–P. indica and 

autoclaved barley roots, B–P. indica colonizing barley roots, C–P. indica on 1/10 PNM, D–

barley on 1/10 PNM. 

 



Results 
 

 

 40 

 

Fig. 14. Lack of laccase activity in P. glomeralium co–cultured with H. vulgare. α–naphthol 

(0.1 M) was used as substrate. A–P. glomeralium and autoclaved barley roots B–P. 

glomeralium colonizing barley roots, C–P. glomeralium on 1/10 PNM, D–H. vulgare on 1/10 

PNM. 

 

 

Fig. 15. Lack of laccase activity in H. vulgare co–cultured with autoclaved P. indica (A) and 

P. glomeralium (B). α–naphthol (0.1 M)  was used as substrate . 

   

3.5 Spectrophotemetric test of Piriformospora indica  

Extracellular activity of enzyme were monitored as a function of time during growth in liquid 

culture (1/10 PNM). Due to differences in the scale of enzyme activity for each enzyme, their 

relative activity was calculated (Fig. 16a, b, c, d). With disregard to the analyzed enzymes and 

harvesting time point, the highest activity for each enzyme was set to 100 %. Subsequently, 

the enzyme activity values for other harvesting time points in each investigated condition 

were computed as a proportion of the highest one.   

The activity of the different enzymes of P. indica as well as of barley grown separately did 

not exceed 40 % (Fig. 16a and 16c). An equal amount of enzymes activity was detected in the 

early time point during fungal colonization of living and decaying plant (Fig. 16b and 16d). 

Presence of living barley in the analyzed system induced only laccase activity which slowly 

increased to the highest activity at 7 days after inoculation and afterwards slowly went down 

(Fig. 16d and 17a). More variability in enzymes activities was detected when P. indica 

colonized decayed barley roots (Fig. 16b and 17b). High laccase production was observed 



Results 
 

 

 41 

earlier (3 dai) in comparison to the case when fungus colonized living host roots. At 5th day 

after inoculation enzyme secretion immediately decrease and rose again on 7th day.  In 

addition, by the second day after inoculation significant increase  in activities of other 

enzymes were noticed. The highest lipase secretion was detected at later times–10 dai (Fig. 

16b and 18d). The highest esterase production was noted after 10 days of co–culture (Fig. 16b 

and 18b). Peroxidase activity secreted in all inspected sets remained small and did not vary 

dramatically within two weeks of experiment (Fig. 16). However, considerable increase was 

detected at 15th day after inoculation in medium (Fig. 17c). No noticeable changes were 

detected in esterase and lipase activity when P. indica and barley were propagated alone in 

1/10 PNM (Fig. 18). These results indicate that the enzymes production was predominantly 

associated with the presence of the symbiotic partner. 



Results 
 

 

42  
 

 

Fig. 16. Relative percentage of enzyme activity for P. indica, barley and P. indica colonizing barley roots (living and dead) cultured on 1/10 

PNM during 15 days experiment period time. The experiments were repeated 3 times with similar results. 



Results 
 

 

43  
 

 

Fig 17. Variation in laccase and peroxidase activity for P. indica, barley and P. indica colonizing barley roots both (living and dead) cultured on 

1/10 PNM during 15 days experiment period time. Standard deviation is calculated from 3 independent experiments.  



Results 
 

 

44  
 

 

Fig 18. Variation in esterase and lipase activity for P. indica, barley and P. indica colonizing barley roots both (living and dead) cultured on 1/10 

PNM during 15 days experiment period time. Standard deviation is calculated from 3 independent experiments. 



Results 
 

 

45  
 

3.6 Piriformospora glomeralium sp. nov. Zuccaro Weiss ex multinucleate rhizoctonia  

The fungus was isolated by Williams in the 1984 from a spore of Glomus fasiculatum 

(Williams 1985) and can be propagated on wide range of synthetic media. On MAE 

colonies grew quicker than on CM, and their diameter measured after 2 weeks’ growth at 

24 °C was 60–70 mm and 40–50 mm, respectively. The fungal mycelium was cream–

colored to pale yellow, mostly plane and submerged into the medium. The aerial mycelium 

was not detected. The hyphae were irregularly septate with diameter ranging from 1.6 to 

2.8 µm. Multinucleate cells contained 2–6 nuclei (Fig. 19c). Chlamydospores were formed 

singly or in loose intercalary clusters and had mostly ring–shaped, very rare pear–shaped 

contained 1–10 nuclei (Fig. 19b), their diameter was similar to that of P. indica 8–12 µm. 

In older cultures plenty of chlamydospores were localized at the tip of irregularly inflated 

hyphae. Neither clamp connection nor sexual structures were observed. The main 

morophological difference between P. indica and the now described species is the 

arrangement and number of nuclei in the cells as well as the shape of the spores.  

 

 

 

 

 

Fig. 19. A. Germinating P. indica spore (scale bar 4 µm), B. Piriformospora glomeralium 

spore (scale bar 2 µm), C. Hyphe stained by Syto 9 of P. glomeralium, and D. P. indica. 



Results 
 

 

46  
 

3.7 Protoplast regeneration 

Fungal protoplasts are normally the best material for genetic transformation, therefore the 

best condition for protoplast preparation and regeneration was investigated. Trichoderma 

harzianum lysing enzymes were used for protoplast production from young fungal 

mycelia. Chlamydospores protoplastation was not successful. Three osmotic stabilizers 

were compared and the best regeneration was detected on medium containing 0.3 M 

sucrose followed by sorbitol, with colonies visible after 3 and 4 days, respectively (Fig. 

20.). In addition, water was used as negative control in order to check if protoplasts solvent 

can influence protoplast vigor and regeneration efficiency. Protoplast regeneration of 

material resuspended in STC was significantly more productive than water (Fig. 21.). 

 

Fig. 20. Regenerationof  P. indica protoplast. A–protoplast achieved after 60 min treatment 

of the young mycelium with Trichoderma harzianum (L1412 Sigma, Deisenhofen, 

Germany) lysing enzymes; B–regenerant after 24 h;  B–autofluorescence of regenerant 

after 24 h; D–regenerants after 48 h; E–regenerants after 5 days (Zuccaro et al. 2009) 

0,05 0,02

5

0,02

0

1

2

3

4

5

p
er

ce
n

t 
o

f 
p

ro
to

p
la

st
 

re
g

en
er

at
io

n

1sorbitol mannitol sucrose control

 

Fig. 21. Osmotic stabilizers test–Percentage of protoplast regeneration after 7 days using 

different stabilizers in the top agar (Zuccaro et al. 2009). Osmotic stabilizers supplemented 

complex medium, control–CM without any additional ingredient.  

 



Discussion 
 

 

47  
 

4 Discussion 

 

Sebacinales, a worldwide distributed and very diverse group of fungi (Weiss et al. 2004), is 

divided into two subgroups. One includes endophytic Sebacina vermifera isolates, P. 

glomeralium (ex multinucleate rhizoctonia Warcup), and and Piriformospora indica 

(Selosse et al. 2007), whereas the second consists of ectomycorrhizae and 

endomycorrhizae species. Available isolates (P. indica, P. glomeralium and S. vermifera 

strains) confer growth promotion, disease resistance and abiotic stress tolerance to  plants 

(Waller et al. 2005, Deshmukh et al. 2006). Moreover they are able to colonize a wide 

spectrum of plants including Mono– and Dicotyledons, and thus may have  potential to be 

applied in agriculture and horticulture. Due to those reasons, it is important to isolate new 

closely related species in Europe. Environmental studies and phylogenetic analysis 

demonstrated that fungi closely related to Sebacinales isolates are present in Germany. 

Analyzed samples were selected from collection of DNA isolated from plant’s roots of 

taxonomically diverse plants such as Anthyllis, Medicago, and Lolium. Phylogenetic 

analysis performed by Weiß et al. (2010) based on the Internal Transcribed Spacer region 

28S nuclear ribosomal DNA ITS – 28S rDNA suggested a close relationship of those 

organisms with P. indica. Further, translation elongation factor (TEF) phylogeny was 

conducted. TEF is a conserved and strongly expressed in eukaryotic cells (Schirmaier and 

Philippsen 1984). Examination of the full length sequences of the TEF gene of P. indica 

demonstrated the presence of 8 introns (Buetehorn et al. 2000), two of them were amplified 

in our study. The investigated TEF introns were identical for all environmental clones but 

clearly differentiated from the laboratory isolates. The TEF sequences used in this study 

are informative of Sebacinales. In addition, phylogenetic analysis clearly divided 

Sebacinales isolates into three groups which most probably correspond to three different 

genera. Those results suggested that TEF genes can be used for design of specific primers 

for different sebacinoid groups.  

 

4.1 Sebacinales genomes size estimation 

Although Sebacinales have a positive influence on plants host, they are recently taken into 

consideration in genetic studies. Lack of a sexual phase make classic genetic analyses not 

applicable. Additionally, the number of chromosomes cannot be determined by light 

microscopy. However, elucidation the molecular processes and identification of the fungal 



Discussion 
 

 

48  
 

factors that lead to a successful symbiosis of P. indica and other Sebacinales with its plant 

partners is essential for better understanding the mechanism of that interaction. Analysis of 

sequences of whole genome seems to be the most suitable method to provide a complete 

story of biological networks. Although genome sequencing technologies developed very 

fast over last few years, some basic studies are required before, to make sequencing 

process fast and further analysis more efficient. Correct genome estimation is one of the 

most important tasks which should be performed before applying genome sequencing 

technologies. It is essential for sequencing costs valuation. We decided to predict genome 

size of five Sebacinales strains using few available molecular methods. Techniques such 

as: flow cytometry, reassociation kinetics, genomic reconstruction, PFGE, real–time PCR, 

confocal microscope can be implemented in that purpose. However, each of them has some 

limitation. Flow cytometry determines relative nuclear DNA content per spore and was 

used for genome estimation for fungi such as the basidiomycete rust fungus Puccinia 

recondita (Eilam et al. 1994), arbuscular mycorrhizal fungus Glomus intraradices (Hijri et 

al. 2004), or the etiologic agent of histoplasmosis, ascomycete fungus–Histoplasma 

capsulatum (Carr and Shearer Jr 1998). Sebacinales chlamydospores are multinucleate 

therefore this method cannot be applied. Reassociation kinetics, reconstruction or real  time 

PCR based on one copy gene analysis. Genomes of a few fungi were investigated using 

those approaches. Genomes of the obligate Oomycetes pathogen Bremia lactucae (Francis 

et al. 1990) and the basidiomycete Paxillus involutus forming ectomycorrhizal symbiosis 

(Le Quere et al. 2002) were analysed using reassociation kinetics (reassociation rate of 

denatured DNA is measured under defined conditions). Reconstruction technique (the one 

copy gene is used as a hybridization probe) was employed for genome analysis of such 

organisms as Phytophthora megasperma f. sp. glycinea (Mao and Tyler 1991) and 

Ascomycetes Colletotrichum graminicola (Randhir and Hanau 1997). A real–time PCR 

based approach was established for strain 368 FY1679 of Saccharomyces cerevisiae, the 

platyfish Xiphophorus maculatus and Homo sapiens sapiens (Wilhelm et al. 2003) and 

applied also for such Ascomycetes fungi as: Cladonia grayi (Armaleo and May 2009) and 

Zygosaccharomyces species (Solieri et al. 2008). False recognition of one copy gene can 

be the reason of wrong genome size prediction. Additionally, real–time PCR requires very 

good quality and quantity of DNA. For some organisms achievement of those terms might 

be problematic. Too big size of chromosomes might be important barrier in PFGE 



Discussion 
 

 

49  
 

approach. Hence, the best way for correct prediction of genome size is combining few (at 

least two techniques), which rely on completely different assumption.  

In that study, genome sizes of analyzed fungi were estimated using real–time PCR and 

PFGE. First, both methods were established for P. indica and further applied for other 

Sebacinales isolates. The real–time PCR approach relied on absolute quantification single 

copy gene in genomic DNA. Based on the presumption that TEF and GAPDH are both 

single copy in the P. indica genome, southern blot analysis of digested genomic DNA and 

chromosomes separated by PFGE were performed. Although in some Ascomycetes and 

Zygomycetes the TEF gene was detected in multiple copies, in almost all Basidiomycetes 

genomes analyzed so far only one copy of this gene was detected. The GAPDH gene is 

also present in single copy in many of Basidiomycetes. However some exceptions such as 

Agaricus bisporus with two different GAPDH genes are known. According to southern 

blot analysis, TEF and GAPDH are one copy genes. Similar assay was used for P. 

glomeralium and Sebacina vermifera isolates. In the genome of analyzed fungi TEF gene 

is most probably present only one time in the homokaryotic genome, therefore it was used 

for genome sizes estimation. Southern blot analysis performed for S. vermifera 

MAFF305842 did not give clear indication concerning the TEF gene copy number. 

Genomic DNA digested with Bam HI and hybridized with specific probe showed one 

band, however multiple bands were detected when Hind III enzyme was used (Zuccaro 

unpublished data). Those findings proposed presence of SNPs (single–nucleotide 

polymorphism) in TEF gene of S. vermifera MAFF305842. Further investigation of that 

gene should be performed. Additionally, for P. indica TEF and GAPDH were localized on 

chromosomes. TEF is located on first chromosome (5.4 Mb) and GAPDH on third         

(2.5 Mb).  

Fungal DNA was isolated using two different techniques: modified method from Doyle 

and Doyle followed by a CsCl centrifugation and FastDNA® SPIN Kit for soil. Results are 

displayed in Table 8. Genome size estimated using kit extracted DNA was 30–50 % 

(depending on strain) bigger than with the second method for all Sebacinales isolates. 

Protein contaminations in samples of genomic DNA were not detected. The ratio of 

absorbance 260/280 was in the optimal range of 1.9 for both DNA extraction methods. 

However, organic compounds were present in kit extracted DNA. The ratio of absorbance 

260/230 was below the optimal value for each isolate. Those findings may explain the 

differences in the genome size predicted using diverse methods of DNA isolation. S. 



Discussion 
 

 

50  
 

cerevisiae (1n and 2n) was used to validate that method. DNA from S. cerevisiae 1n was 

extracted using both method (Doyle and Doyle followed by a CsCl centrifugation and kit). 

The genome size predicted using primers specific for the ScRPS3 gene was in the range of 

the known genome size for this organism (12 Mb). Extraction method as well as the ploidy 

of organisms used for DNA isolation did not influence genome size estimation. Those 

results might suggest that Sebacinales cells contain some components which strongly 

interfere both with buffers used for DNA extraction either directly with DNA and inhibit 

extraction procedure. Without consideration of DNA extraction method, S. vermifera 

MAFF305828 seems to have the biggest genome and, S. vermifera MAFF 305830 the 

smallest one in between analyzed Sebacinales strains. 

The second method implemented for genome determination was Pulse Field Gel 

Electrophoresis. PFGE is an effective technique for separating big fragments of DNA such 

as chromosomes, and is a meaningful tool for basic genetic studies, especially in lower 

eukaryotes such as fungi. Chromosome–sized DNA molecules of Sebacinales isolates were 

successfully obtained after young mycelium protoplastation and resolved by PFGE. The 

electrophoretic conditions permitted the separation of 6–7 chromosomal bands in the range 

of 1.3 to 5.4 Mb for P. indica. The total size of them agreed with the genome size 

estimated by quantitative real–time PCR. The karyotypes achieved under these conditions 

were reproducible. The staining intensity of the chromosome bands 3 and 5 was more 

intensive than other bands. The separation in this part of the gel was not satisfying. Those 

results displayed the possibility of attendance either heterologous chromosomes with 

similar or identical size or multiple copies of a homologous chromosome. Among the 

investigated isolates the karyotype analysis confirmed that P. glomeralium is the closest 

related fungus to P. indica. Similar genome size and number of chromosomes separated 

those two fungi from S. vermifera isolates. The large size of S. vermifera MAFF305842 

and MAFF305828 chromosomes was the reason of not adequate separation. Nonetheless, it 

is clear that the smallest chromosomes from P. indica (about 1.3 Mb) and P. glomeralium 

(about 1.5 Mb) are not present in the other isolates. Specific differences in the chromosome 

profiles within isolates from the same clade were also evident. The genome size 

determinated by PFGE in an organism whose ploidy is unknown may lead to incorrect 

conclusions due to incapacity during separating homologous chromosomes (Torres–

Guerrero 1999).  



Discussion 
 

 

51  
 

Despite the clearly diversity in the chromosome profiles among isolates, genome sizes 

estimated by those two techniques did not vary particularly within the clades. 8 % 

dissimilarity was observed between P. indica and P. glomeralium and a maximum of 28 % 

within the Sebacina vermifera strains from clade 3. Those differences might be present due 

to gene duplication or loss, horizontal transfer events and transposable element. P. indica 

genome size was additionally analysed using confocal scanning microscope. The staining 

procedure applied for chlamydospores and hyphe worked very well. However microscopic 

observation, in the same set conditions, such different structure like hyphae and S. 

cerevisiae cells, used as a standard organism, was not possible. Genome size estimated 

using that technique confirmed genome size to be in the average of 22 Mb. The dimensions 

of genome sizes support the thesis that sebacinoid fungi from the subclade B (Weiss et al. 

2004) hold a relatively small genome. Genome sizes among known Basidiomycota ranged 

25–125 Mb, with high level of repetitive DNA. Such genome sizes are characteristic for 

mushrooms like Coprinopsis cinerea (37 Mb, Stajich et al. 2010), Schizophyllum commune 

(38 Mb http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genomeprj&cmd=ShowDetailView 

&TermToSearch=12852), Puccinia graminis (81 Mb, http://www.ncbi.nlm.nih.gov/ 

sites/entrez?Db= genomeprj&cmd=ShowDetailView&TermToSearch=12848). Pathogenic 

Basidiomycetes possess smaller genomes. The plant pathogen Ustilago maydis genome is 

20 Mb (Kämper et al. 2006) or that of Cryptococcus neoformans causing a human disease–

is 19 Mb (Loftus et al. 2005). Despite small genomes, Sebacinales are free–living and non–

pathogenic fungi. The TEF sequence analysis suggested already that P. indica introns 

might be small. Moreover, investigation of genomic date achieved after pyro–sequencing 

implying that P. indica has a very compact genome with very less repetition (Zuccaro et al. 

in prep.). Sebacinales genome size predictions additionally proved that analyzed 

Sebacinales strains are distinct and supported division those isolates into 3 clades. 

An additional band smaller than 0.2 Mb was often observed for P. indica on the gel after 

PFGE. This band w